CR70059

CRIMIC CR70059

Gene TBPH

CG10327

Information

Donor Location Cytology FBti Stock number
int100_PM37_kG4 2R:23859067..2386259360A4-60A5

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GCGATTCCACACTCACAAACG CTCCTCTAAAATGAGGCTGCGC

Images

Construct Design Sequences

sgRNA sequence TCTAGCAGCCTTCTAGGAAATGG
sgRNA2 sequence TAACCACATCATTGGGTGACAGG
 
left_100bp right_100bp
GTTGACTGAATGACATGGTGGATCATTTCTAGAGCGAAGTGTGAGCCCCTGCGGCGATAGAGTTCTTTAATCCCCTCCTCGTTTCTAGCAGCCTTCTAGG ACCCAATGATGTGGTTAATGTGGTTAACCAACACCTCTGTAGCTTACTTAAATTTACATATATGTATTCCACATACAAACCAGTTAAGAATTGTATTTAA
 

Search Again