CR70062

CRIMIC CR70062

Gene CG12231

CG12231

Information

Donor Location Cytology FBti Stock number
int100_PM37_kG4 X:19531032..1953174218C8

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK ATCCAAAGCAGGCAAATCCGCAAG CTAGCAAGCGGTATCCACATTGGA

Images

Construct Design Sequences

sgRNA sequence TTCCCAACTCCTGACGTTCGTGG
sgRNA2 sequence TGGAGACCACAAAGCGTTCGAGG
 
left_100bp right_100bp
CCAGGAGGCGATCAATCATATCTCAATAATAACACTAACCAACCAAATCAACTCAACTCCACGTATTTAAATTCAAAGTGTCCTTCCCAACTCCTGACGT ACGCTTTGTGGTCTCCAGTCCATCACATTACCCTCACTTCCGTCAATTTCAGCTCTAATCTTATACACATATATATATATATATAGATATCGCTTGAATT
 

Search Again