CR70063

CRIMIC CR70063

Gene CG12237

CG12237

Information

Donor Location Cytology FBti Stock number
int100_PM37_kG4 X:19641191..1964286918D11

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GCAGCTGGATGCTATGAAAGCTTTGG GCACACCTCCGAAGTTGTACTGTT

Images

Construct Design Sequences

sgRNA sequence AGCGCATCCATAGCCGGAGCAGG
sgRNA2 sequence GAGCACATGCCACCTTAGTTGGG
 
left_100bp right_100bp
CCTGGCATTTAGCATCGTGGGCGGCGCGGACACACTGGTCCTCGCACAAAACTCGCACTCGAACTTGCTCTCCGCGCGCTCTGAGCGCATCCATAGCCGG TAAGGTGGCATGTGCTCGCATTTGGCACCGGCACGAGTAAGTAGAACGGGTAATCCTCGAGAGTGACGATTGCCCAGCTGCAGGATGGCCATCGCATAGG
 

Search Again