CR70064

CRIMIC CR70064

Gene lrrk

CG5483

Information

Donor Location Cytology FBti Stock number
int100_PM37_kG4 3R:20635480..2064427992F4

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GATGACCACCTTATCGCGTTTTGG CCCTTCACTTATCGGATGCCGATT

Images

Construct Design Sequences

sgRNA sequence AACACATACCATGTATGACTTGG
sgRNA2 sequence AGTGCTTGGCGCGCCACAGCAGG
 
left_100bp right_100bp
AATTTCGCAAAATGTGCAAAATAATTAAGTAAGGGTCAGTAAAAGGTGCTACTGGTTAATCGGACCATAACAACTACCCATTTAACACATACCATGCATG
 

Search Again