CR70130

CRIMIC CR70130

Gene mAChR-C

CG12796

Information

Donor Location Cytology FBti Stock number
int200_PM37_kG4 X:6831397..68326846D4

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CTGTTTACCACGTATCCCAGTTGC GCGACGTTTCACAGACTTGTTC

Images

Construct Design Sequences

sgRNA sequence TCGTTTACCATCGTGGCTCATGG
sgRNA2 sequence GAAGGCCACTCAGTGATCAACGG
 
left_200bp right_200bp
AACTGGCGCGATGACGATGTCGTAAAGCCACCAGCGAAACGTAAACAAACGACGCCCACGGTCCGAGCCGAAACCCAATTGAATCTGAATCCGATCCGAGCCGAGCCGAAGTCCTGGCCAAAAGTCAGCACAGCTCCAGCTCCCACGGTTGCCAGATAGCCAACCACTGGCGTCGCGTGCGCTTCGTTTACCATCGTGGC CAACGGAATTGGGAAACCCAAAGCTTTAACTTGGTAGAATTAAATGGAGATATAGCAATAAAAGTGGACATTATCTTTAGGAGCACCGTTTCTTCAACACCCCCAGCAGCGATTTGTTGAGATAATTGATTGGTATAGGATGAGCAGTAGTCTTACCTCGATTCCTGTGATGCCCATGGCCTGCACTAGATTCTGGGTAA
 

Search Again