CR70730

CRIMIC CR70730

Gene nrv2

CG9261

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p1:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
CCAGTACCAATGAGTCCGTCC GATGATAAAGAGTGCGGCGGA

Images

Construct Design Sequences

sgRNA sequence TAGCCAATGCGAGTCGGATTCGG
sgRNA2 sequence
 
left_200bp right_200bp
AAGCCCAAACCGTTCAAATTGGGCCAGTTCTTATATAACACCGAGGATGGAACGGTTATGGGTCGCGATCGATCGTCATGGGGTAAGTTTATTGTTTATTGCCGTGTTTATTGCTGTCCGGCCAAAACTGCTTTCGCTGGCATATGACAGCTGTAAATCAGGCCCAAAAGTCGTATTTCATCGTAGCCAATGCGAGTCGG ATTCGGGAATGTATCTCATAAGCACGGCGCTGCGAAAGTAACGCCCATTAGAGCGTCTAAAGTGCCGCAAGTTGCACACATTCGTAAATCAAAAAAATTAAAGTACAGCTCGCGAGGCGACGAACAAATTAACATCTGCATGTAACGATGCTGGGAAATGGGAACAAATTAGGGCGTGGAAATGCGGCATCTTACTTCTT
 

Search Again