CR70969

CRIMIC CR70969

Gene Dronc

Information

Donor Location Cytology FBti Stock number
:9968479..997100267D2-67D2

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GAATCCGTCGATGAGTCCG CGTGCTATATAAACACAGCTGCC

Images

Construct Design Sequences

sgRNA sequence
sgRNA2 sequence
 

Search Again