CR01378

CRIMIC CR01378

Gene Cpr49Aa

CG30045

Information

Donor Location Cytology FBti Stock number
pM37-p02R:12377024..1237703949A1Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK GTTAACCATCTCACGTAGCATTGGGC CGACCGGTGACTTGATCAATTAAGCG

Images

Construct Design Sequences

sgRNA sequence TCGTTTGGCCAACTGGTAGCCGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CGCTGCCGAGGATGAGTTAT CAAATGCCAGGCACGACTG GCCAAACGAAACGAGCACTA CAGCCGGCTGTTGAAACTTC
 
Amplicon 5' Amplicon 3'
CGCTGCCGAGGATGAGTTATGAATGTCAAGCTGGTCATGTTCAACACGATCCGAGATGATCATAGTGCCTCCAACGCCCCTCGCAATACAGGTGCACAGTGGGCGATGGCTAGCTAGGATAGTTTCTATTGCAGCAAGCAATTGAAGATGCAACTGTGCTGATGATAACTTCCAGCATAACAACTTAATGTTGTGAGATATTATACTAAACTATATTTTTCTTTGCTCTAATGATAAAGTAGAGTCCCCACTGTGGCTGTCATGTAGACAACTCATTCGACAAATTGCAGCATATCGGATGGGTCGTGCACTTGTAGGTGGATTCGATTCGATTCGGTCCGGTCCGGTTCGGTTCATTTGCGCTCCATGGGAGATGGTATTGGCCTCCGACAAGAGCCACCTAAAAGAGGCTTCCGATCGGCGGGTCTTCAAAATGCTAGGCGTTCACTCTTTAATCTCCAACTGCAATAGTGTCTGTGTGCAAAAGTTCAAGCGATTTGGTATAAATATGCAAAGAGTCGCCTCTGTTGACCACAGTAACGGATCGAGACGAACTCGGAGCAGACGACCAGGACCCAGGATCACAGGATACAGCTCGGTTCGACATGCAATACACAGTAAGATGGAAGAGATCAACTTGGGTATACTCCATGCTGATATCGCATCCGCGTGCTTTCAGCTGCTCTTCATAGCAGCCCTGCTGCTCAGCTTGGCCCAGGCCAGACCACAAGTGAGAGGCCAAGCGCCGGGAGAACCCATTCCAATTATCAGACAGGAGCAGGAGGTCAACTTCGACGGCTCCTACAAGTATCTGTACGAGACGGGCAACGGCATCAACGCCGAGGAGGAGGGCTACCTCAAGAATCCAGGCACCGATAATGCCGGCCAGGTGGGTGTAGGAGAACTCCATTCACAGTCGTGCCTGGCATTTG GCCAAACGAAACGAGCACTAACTTGCATTTGCCCTTTTACCGCTCCAAAGGTCGCACAGGGCTCCTTCTCGTACACCTCACCCGAGGGCATTCCGATTCGGATAACCTATCTGGCGGACGAGAATGGCTTCCAGCCGCAGGGCGACCACCTGCCCACGCCGCCACCCATCCCGCCTGCAATCCAGAAGGCATTGGCCTACTTGGCCACCGCTCCGCCGCCGCCACAAGAGCAGCCCGGCGGGTTCAACAACCGACGTGGTTAGGTAATCACATCGACTTCTACAATCGAATTACCTGGTTCTACTCAATTACAAAACGTGTGCGAATGAACAATAAAACTGGCCATACAACAACAAATGCAGAGTGGATTTTCAATGATTAGCAAATGATTTAGCTGTGGAATTTAATACTGACTTTAGTAGACTTAATCAAGTGGCAGATATGCAATCAAACGATGACGTCTTGCGATCTAATGACTAATGATGTATTGATTTCCAATTTACTTTTGCGTTTGGATCGATTTCTTATGCGATTGTAAATATATTGGAAATAACCCGTATTCAGATAAGATTTAACTCACTTGGGTCCAATTCCTTGACCTTACCCTCGTGAATCAAAATATGTACTGAATATTCTGATTTTATGGGCTAGGCGCGTGTGGTCGGGAAAACCTTATTCATACTTGTTCTTTAATGAGGGGGATGGTAAAACAGCCTGATTTTTCTAGATAAGATTTGCAAAGACTTAAGTTCAACTGAACCTGAAGAAAGTAAACCAAATAAATGCGTTAGAATACATGCATAACTTTTCCATAGATTTTCATTTTCGATGTATAATATTGGCCAATCTAATCATGCTTGTGATTAATATTATATTAAATGGATATCATTAAACTCATAGTAGACTTAATCGATAATAATTTCATTAGCTAGTGCGGCACTCTATTCCAAATGGAAAGATCTTTATCCATTCAGTCAGCTTTAATGATCATTACAGGGCACGCAATATTATGTTGCCTAGTTTCAGGCATTTGGCATAAATGAAGTTGAAGCGGCTTGGAATTGTATTATCTTTTCAAGAAACGTGGACAACGTCCGAATATCGTGGTAGTACCTCCAAGAAGTTTCAACAGCCGGCTG
 

Search Again