CR01406

CRIMIC CR01406

Gene CG15083

CG15083

Information

Donor Location Cytology FBti Stock number
pM37-p12R:18835671..1883569955F6FBti021035186364

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK

Images

Construct Design Sequences

sgRNA sequence CGATGTCGTCATCGATGGTGAGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TAGAATCACGCCCAGCCATC GGTTGTGAATTGGAACGCG TGACGACATCGCCGACAAAT GCTGGCTTCGCTGTTTTTCA
 
Amplicon 5' Amplicon 3'
TAGAATCACGCCCAGCCATCCAATGACCACACCATAGGTGTTCAGGCGCATACAGAAGACCCTGGACAGCATTCTGGATTCACTTGATTTCGTGCTAATGCGAAGATAAAGACAATTTTACTTCAGTTCGCCGGCGCAGCAAAATTGCAATTGCTTGATAAGTCGCAATTGGCTGACAATTAAAAGCTTTTGGGTACAGCGGCGTTGCCAGACTGGTTCAAGCAGTTGGTGTCGAAACTGTGACTTGTTCACCAGCTTTTAATGTGACTTTTTAACGCTAATTGTTTAAAATTCTTTTAATAACATTTTTATATTTTAAATATTTTTATGCATTTATTATTTGGCATGATAGTTAAAAAATATTTATTTATGTATTCATTAACACTGCACAGCAGCGGCTTACTTTCATAATATTTTTCAAGGTGCTAATAGTAGCTACATTACATATATAATACAGCATTAAATCTCTCTATTATTTTAAAGACAATTCCCCATTTTATTCATTTCACTCTTAAATGACGAAACATATGCAAACAAATTCATATAGTAAATGAGTGCACATATATTTTTTAAGAACATATCAGACGTAGTTTTTCCACGCTCGAAAAAAAAGTATTTTCGTGTTGCATAGTTTACGCAACCGTTTCTTCTGAGCGGCATCGGCATTTGCGCCACACTTATTATTTGATTCTTGCCCAGTGCGGTTGTGTTTCCGTGCGCTAGGTGTTCCCAAACCGGTTTAAGTGCCATACTAGCCATATTTGTATTTGGAAAATTCGCTGTAAACCACAGAGTTTCAAAATGAAAATCGATCTGACGGTGGAAAATGGCCCGTGCAATACCGATTTGCGGAGCTGGTGCCTGGGAATCGCGATCTATTGGCTATTGAGCATGACTTTCAACGTTATATTCGCTCCAAACGGTAGGAGAAATGCGAGAGGCGTGGCATTTGTTTATTTTCAGAAGCTGATTGCCCAGACTGACGCTATTTCCATAGAGAGACAATACATTCATGATGTTCACATGCGAAATAAACGAATGAGCTAATCCATTCGACACAAACGCGTTCCAATTCACAACC TGACGACATCGCCGACAAATTCGAGCTGACAATTCATTTTAGGTGGCCCGAAATGCCATTTTCTCACAGGCTTGAATTTTCCAGCACAAAAAAGAAAATTAAATAATTTCCTTGGGCTGTGCATGGCGCAGAATTAAACTTAAAAGATTATTGGGTTTTAACAGTTGAACGCCATATGTCATAAAAACACTTAAAGCCCTGCATTTGTCCATGTCTCAAAGAAGTTCTATAAACCTTATTCTAAGCTGTTTTAAAAAGTTTGTCATATTTCATGTATGAAATGTGTTTAAAATATAAAAGAAGAATTTATGTTTTAGTTCTTTATGTATATGTACACATGTACATGAAGTGCATCAGTGCATCAATATGTACTCATTATATACGAAGATACATTTAGCAGTCGTGTTCTCAAATTTCAGACGGGAAGAAAGATAAGAGCACAGCAACGTTTTGCTTGGAATACATTGAGTCACTTATAAGCCCAAGTTTATGTTTACTTTCCACTAATTGTAACGGCTTTTTTTATGAATGAAATATGTACGTTCAATAATTTCTATTTAAATTCACTTGAATCCTTGCAGTTCTTACCTTTATTGGATTTGCCATCGTAGTAGTCGCCAATATTTGCTTATTGATAGGAACCCTGAAGGTAAATAAAATACAACCCATTCCGTTTTATTGAGTCAACGAAACCCAATCTACCTTTCCGAATTGCAGGAAAAGCCAATTCTGGTGTTCGTCTGGCTGATCTTCGCTGCCATTGAAGCCATCTCCTTTCCGTTTGCCGTCTTCGGGGTTATCTTCCACTACGGAGGATATCGCGAGGCTACCGGAATGAACAACGTTTTCGGTGCCCTGCTCGTTTACATCATCACATTTCGTAAGTATCGGCTATGAACATCAAATTGAGTTAACAAAAATGTACAGATCATACATATTCTCCGCTACACTTTCAGTATTGATCCTCTTCAGCGCACGAATTGTGTACTCCTTCTACCTCCAGCTGAAAAACAGCGAAGCCAGC
 

Search Again