CR01413

CRIMIC CR01413

Gene nw

CG43164

Information

Donor Location Cytology FBti Stock number
pM37-p12R:17505290..1750529354B18Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK

Images

Construct Design Sequences

sgRNA sequence TGAATCATGCGTCCGATTTGGGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GGTCTTGGACTCGCAGTTGA ATCGGACGCATGATTCACGA GGGGCTCCAAAGTTCTTCGT CGATTTGCGTGTGGTTGTGT
 
Amplicon 5' Amplicon 3'
GGTCTTGGACTCGCAGTTGAATTCACGTCCAGAGTCAGTGTCAAATTAACTGCAATTGGGACGTAGCTCGTTATCTTCTCTCTCCAAGTGCCTTGGACTATCCATCCACTCCGAATCCGATTTAGATTCGCCATCAAGCTGAATTCATTTGGGTGAATTAATGCTTGAATTGTATCCGTTCCCTTGAGCTGAGCTCCAAGCTTAAATTGGCCCATTAAAATGAAATTTAAGAATTTCTTCGACCCGTTGAGCTTCTGATCTCATGGCGTGGATCATTATTCTTATTAGGTAGATGGATATCTCAGCTCCTCGGACGCATAATAAGTTGCCCAATAATCTTTTCATTCATAAATCTTCGCCACGACTTGTCTATCATCAATCTGATCAAAGGCAAAGACTTTGAGTTGACTTCGTGTGTGTCTTGCATTTCAATCGCCGGAAATAATTTCATATACGAGCAGAGTACCCACTTGGGCATGATGGTGAGTGTGTGTGTGTATGTGTGTGTGTGCTCAAATACTGGAACTCTCTTGATGTCTAGGCCCATGTCTATATATCCTATATCCCATATCCCATATCCAATGTCCATCCAAGACAAGTGCCATAAATGGCCAAGTGCCCGGGGTGTTCGTTGAGTCAGTTGGAAAACAAAGTACTCGCTTTGGTATTTGTGTTTATCTTTTGAGCCGCTTTGTAAAAGGGCCAACCACACACACAACGTATCTCGTATACAGAGATGTGTACACAGATACTTTGTCCCTCGACTACCTGTTGAACCTGAACCCTATACCGAACCCATTCCCAAAGTCACTGTCATCTTGCATTGTTCCCAGCCTCGCAGACTTCTCTTCACTTCACTTTACTTCTCGGGTCAGCGATTACATAAGATTCGAATGGGTCTTTGGCTCTGCGTCTCCATTTCGGGCTGACCGGCGGGCTAATTAATGTCATCAGCACCTTGAGTCCCCATTTCGGATTTCGTGTAATTAGCCGCCAGAGGTCAGGGACCGCATAAATGCTCCTGGTCATCACCATCATCATCATCTTCGTGAATCATGCGTCCGAT GGGGCTCCAAAGTTCTTCGTTTTGTTCTTCGTTTTTATGGACTGGCGGCCCAACGATGGCTAGCCACTTTTTTTGGTAATCCTATTTAATGATGTTTCTGTGATTACGAATGCTATGTCCGCAGTTGAAACCGTTACCGTTTTCGCTGTTTCGGTTACGCATTGCGATTCCAATTGCGTCTGGAATCCGCAGATATGGGTAGGTTCATTAACCTAAGGTCTAATCCACTTGTGGTACCATCATATGACCAGGCCTTTGGTATTTACAGATGTCTATAATACTATTGAAGATCTAAATTAAAAGTATCTTGAATCATAAACCATGTTACCTTCATATTCTATAGGTCAACGCATTACGACAATCCACCTGGATGGAGTGCAGTACTTCATCAGCCGAATGAATCCCTACTCCCCGGAGCTCAACTACTTCCTGGCCTACCAGTACTGTCGCTCCCTGGGCCTGCAACTGGCCTCCTTTGAGACGAAGGAGAAGGCCGAGTCGATGACCACGTATCTGAAGAATGCCGGTTACGGCAACTACGATTTCTGGACCTCCGGCAATCGCCTGGGCACGGGCATGTTCCTATGGATGAGCACTGGTCTGCCGTTTAACGCCACTTTTGATTTCTTCGAAAACTCGGCGGACGCCATCCAGGCCGGTCTGCTCGATCCCGTCGATCATAATAGCAACACCTCACCCCAGCGCACCGCTCGCGACAGGTAAGGATGACAAACTATCATATAGGATGTAGCTCCCTGATGCAGAGAAAAAAATAAGTGATTACTTCTTTCTTCTGTGCCCTGTACTCCCTTGACTATGACCATCTACATCGATATCCTTTCTGTTTCACCGATCCAATCTACAGCAGCAGTGGCGCCGAGAAGGGATGCGTGATCCTGAAGCAGCCCACGCTCAAGTGGATGCCCGAGGACTGCTCGGCCGTGAAGGACTTCATTTGTGAGCAGACCCGCTGCTACTACTACAACTACGGCAGCATCCCCGTCTCGTCGGCGCAGGGGTAAGGACACTTGACCGCGGAGCCACTCCACATAACTCCACCACTCTACACAACCACACGCAAATCG
 

Search Again