CR01434

CRIMIC CR01434

Gene CG14752

CG14752

Information

Donor Location Cytology FBti Stock number
pM37-p22R:8591499..859152144D4Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band OK TCTTTACCACCGACCAGAGGGTCTTA AAACGGCGAGTATGACGTCGGATACT

Images

Construct Design Sequences

sgRNA sequence ACTGATTAGCTAACAGGCGATGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TTTTCGCTTGGCCGTTGAAG TGCTTGAACCCAGCGTCTT GGTACATGGCATTCGATCTAACC GCTTCACTTACCCGACTCCC
 
Amplicon 5' Amplicon 3'
TTTTCGCTTGGCCGTTGAAGTTGCTGCTGCTGTTGTTGCTGCTGCTGCTGCTGCTGTTGTTGCTGCACCGACGTCACGTCTTTCTCGTGCAGCGCAGTCGGCTTGCAGCAACAACACAAAGCGCTGCTGGCGCCCGGTATAAAACGGATGAGTCGCAGCCTGTGGTTATCAGTCACCACCTGACAGTGCTCCGGTTTTAGTATCGCCTTTCGAGTGCAGCAGAGCTCAGCCCAGCCACCATGTCCGTCCTGAAAGTATTCGTAAGTGCGACAAGGATAACGTTCGAAAAAGTGTTAAGCCAAACCTCCGCGGAATGGAGCTGAAAAGGATTAAACTCATGTGGACTATCGTGAATAAAACTAACCAACTGAAACATAACAAACTCACTGAAAACTGACTTCGATAACCGAAGTATTGGAAATATACCACCAAGATCGCCTGATGGCTTAAAAAGTCTCGAATAGATATTTCAAGAAACTGCGAAAGCATTTATTTTGCAGAAATATAAATTCACCCAAAAATATTAGTTTATGTTTATCAATCGCGGACTAACATTTCATTAGATTACTTAGATTTCACCAGAATTGAACATAAATTTTGAAGTGCCAAATTAAAACTAATCACACTGATTAGTTAGCTATTTGCGTTAATCTAGCCGGACCTAACTTACTAACTTCCTTATCCCCTTTCAGATCTTCGTCGCCCTCTTCGCCGTGGCCTACTGCGCACCCAGTCCCGGCTTCTTTGGCAAACAGTGAGTATCGGCGGCGATCTGCACCTGAACTGATCCATAAATAACCCGAGCGAATCGATAAAAATACCCATTTCCCGCTTTATGCTAAGCTAACGAGCGGTCGCATGGCTTTTTAAACGCTGCGACTGCTCCGTGGGTCTATGAAATATGTGTCCGATTGCGATCGAATTGAGCAATCAAAACGCTTGTAGCACTTAGAGCCCCAGCCCCCTCCAGCAGTCTCTATATGGTGCCCACCACTGGCTACCATTGAACTTAGCCGATCTCGACTTGGCTTGGCTCGCGGCTTAGGAATTTCGCAGGCGGCGGTTGGCATTTAATTCAGCGTAATGCGCGCATAATTGTGCGAATCAATTGCCAATTGCCAATAGCCAATATGCAATAGCCATGTCTGCCAAGACGCTGGGTTCAAGCA GGTACATGGCATTCGATCTAACCGATTTCACTTTCGATCCGCAGCGAGCACCACACCATCCACGTGCCCTACAAGGTGCACACGGTGCACCACCATCACGTTCAGAAGGTCCATGTGCCGGTGGTGAAGCACGTGCCGGTGCCCATTTACAAGGAGGTGCCCGTGCACCACGTCCACCACGAGGAGATCCCCGTGCCGGTGCACCACGTCCATCACGAGGAGATCCCGGTGCACCATGTCTTCGATGACCACCACGACCACCACGGCTGGAGCTCCCACCACGGACACGGCTGGCTGTAAGCCATCTGCCCGCTGGCCTGCTTGTCTTCAAACCCACCCACTCAGCCAGTCCCATCTGAAGCAGCCTGTAAATACTGTACAATGCTAAGTTAATGAATGTAAATAAATCACAATTCGACTGTACACAGAACAATCCTGGCGTATTTATGGCAGGATTCCCTGAAGTGGAACCTTAGTGTTTGATGGCTCACAAGTAATCTAATAAACCAAATACTTTTAATGGGAATGAAATAACGATTTTGTTATTTGAGGCTTTTTAAGTTGTTGCGATTAGGATAGATGGTTACTTTTGAAGACTCGAAACTTGCTTATCTCTATATTTATATACTATATAAGATGGTAGAATATAACCTACTTGTTAAGTAATATTTTTCAAAAGATTTTTGTTATCAGTGACAGAACTTGTACACATAAAATAAAAACCCCATATACTCAGATACTCAAATACTAATACCCTGATAGCAAATAGCCACAAATAGACACACTACCACATTTGCACCATGATATATCTACAGAGTTGCTGCTGCTGCGTGGATCTGCGAATCGGAACCATAGCAATAGGGATTTTGCACATTATAGCGGATATCCTTGGAGGCACATTTGTTGCTTTATTTGGGGAGTCGGGTAAGTGAAGC
 

Search Again