CR01441

CRIMIC CR01441

Gene CG1441

CG1441

Information

Donor Location Cytology FBti Stock number
pM37-p22R:9900927..990094746C4FBti021037686390

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence GGGATTAATGGGGCCACGTACGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TTGCAGTACATGGTGCGGAT GTGGCCCCATTAATCCCCAT TCCACCTGCCACCCACTC TGTTAAGCGGGTCCAAGTCC
 
Amplicon 5' Amplicon 3'
TTGCAGTACATGGTGCGGATGACACCCTTTCCGGCTCCGATAAGCAGGCCGGTGGGTCCGTTGATGTTGTCCGTCCAGCCGGGAATGGGCTCCTTCCAGATGGGTATGACGATCGAGGGGCGCAGGATTACGGCGGGAAGCTCTTCGAACTTCTCCACCACCAGCGCCTCAGCCAGTGACTTGGTGTAGGCATACGTGTTTGGGATAGCCCCGAGCACCTTGCGCTCGATGGTGGCCACCTCGTCGTCCGTCAGCCACTCGCATGCCTGCATCACCTTGTGCGGATCTGCTGGTGGATCGTAGGGCTTCTCGTACAGCGTCTTAACGTGCAGGTGGCAGTACGCCGTCGAGCAGTAGGCGAAGAAGTCCAGGTGCTTCAACGTCAGAGCCAGCTCCAGCATGTACTTGGTGCCGCGGGTGTTCATGAACACGGCATTTCGTAGGGGTTCATCAAAGCTGGCCAAGCAAATGGTATAAAAGTGCATAATTAGAGGGATGTACCTATAGACTTAACATTAAGTAGATGGTTTTAAGGCCATAAGATAGGGAACGGATGAGTATGCATAGATACTTACCGCACTGTAGCTGCACAATGGTACACAATGGACACCTCCTGGCGCAGAGTTTCCAGATCTTTCTCGGAGATTCCCAGGCCTGGCGAAAGGACGTCGCCGGCAATGGCCACCACTTGCTGCAGGATGTGCTCCTCGCCACGCATCTGCTTCACTTGGTCGAAAAGCTACACATACACCACACACCACACGCCACAAGTAATTTGATTAATTTCGTAAGCCAGGCAATGAATTCTTATAGTTTCCATAATTCCCACCCTGCTTACCACATTCTGGAATATATCCTTGATGCGCTCCTGAGGATCCTTGCCCTTCTTAGGGCGGATGAGCAGATAAATGCGCTTTAGGCCACCGCACGAACTGCACGAATTAATAATATTGCATAAGCCATCGCGGAAATGGGGATTAATGGGGCCAC TCCACCTGCCACCCACTCCACCCACTTACCGCAGCAACTTCTCGACCAGGACCTTGCCCAGGAACCCAGTGCCTCCTGTGATGAACAGACTGCGACCCTTGAAGCACTCCGCAATGCGGTCCACCTCGTTGTCGTCTATCTCCCCAATGGTGCCCCGGTCATCCTTCTCATACACAAACTTCGGCTTGGCGGTCATCTCAAATAGCTTCTGTCACACATAGAATCAAATCATTGCATTAAGTCATTTTGTTATGGTTGAGTATTTTGGGTACACACATTTAATTTTCTTGGGAACTATCATTTTAAACTATAGATTTTCGATATAGATGCAAAGATAGAATTCCCCTTCCTTTCAGATTGAATTTAATATCTTGTAACTACCACTGGCTTTAATACGTATGCCTATCAGAAAATATGATCTCTAAAATGGAGTTGACATTGTTGGGTCTTTTTGGACACTTATGTATGTATGGGGCTGCGACCACGTAATGGCCGTCGCCGCCAAGTGCACTTTTAATTTCATTTGATCTTGGCTGTAAAGTGGTCGTAGCCACATGTGAGTACGAGTATGAGGCAACCAACCAGTTAGCCGGCGGAGCGACAATTGCAGATTAGGCCACGTTTGGCTGACTGGCTGGACAGTGGCCACATAACTGGCTGGCTGGGTTTCTGAGTGTCAACGCAGTGACCATCGAGTGGGCAAGCGGAGCGACACCGGATTGGCGTTACGGCACTAATTAAGCTATTGCCACATCCCCACGTCCACATCCGAGCCTATGTCCATGTCGCATGCCCCACGATTCGCACCATGAGCTTGCCATGGGCGGTGGAGCATGCCGGGAGCACCTCGTGTCCTTCATCAACTCCACTCCGATGACGTAAACTTGATCGAAAGCCGTTGGTCCGCTGACACATTGACCCGCATTCGACGCACACTTGGTTATTAGACGGCGCGGACTTGGACCCGCTTAACA
 

Search Again