CR01535

CRIMIC CR01535

Gene Tsp5D

CG4690

Information

Donor Location Cytology FBti Stock number
pM37-p0X:6069131..60748575D3

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK no band AGGTCGGACGATGACAGCTCAAGATA GTTTCAATGAGCACGTGGAACTGG

Images

Construct Design Sequences

sgRNA sequence CAGCTCGACGTAGACTTTGGCGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CCAACCAGGAACTCGCTCAT CGGCGTGTTTACCCTTAGCT ACGTCGAGCTGGAAACTGAA GACAAATGGACGGCCCTGA
 
Amplicon 5' Amplicon 3'
CCAACCAGGAACTCGCTCATGAACAGCATTACAATCAGCATAAAGTACTGCGGGTAGATATGATATTGAATGGCTTTGCACAGAAAGAAAATGGTCAAAAAAAAGTACATAGATCACAAATTCGACATGCATGTATGCCATGAGCTAAATCCTCTCCGTTGACCCTGATTTACCCCCGATTTACTCACCAATACCAGGAGACAGCGGGATTGCACCCAGGCGCCGCAGCAGCCAAAGAAGCTGACCACAAATCCGGTGCCCCCGATGCCCATGAAGATGGTGTCCGCACTCAGACCTGCGTGCTGGGGCAGCAAAGTGGCGTATCCCGCGTAGCTCAGTCGCAACCAGAGTCCCGCTCCTAAAAACGCACAGCTACATAACTGCAATGGGTCAGGTTGGGAATTGGAAATTGGAAAATAGAAATTAGAAAGGCACTGATTATCCAGCAGAATGCTCGAAAAGTGAGAGGTGGTAGCTGCATACCTAAAGGACTCAAAAAGCTTAATATTTGATATAAATCAACGAGTCAATTATTCCAGACAGTGTCACCTGGACACAGACCTTGATTTATTGCTCTTTGCTGCACGAATAGCTGAAGGATCTATCATTCAGAGGCGAAATCAGATAATTCCCCCGATTGACGGCCAAATGGAGAGCTTTCGATTGCAAACTGTTGCATGTTCACAACGGCCTGACATCTGACATTTTCAGGGACTTCGGGGGAAACCCAGTGGCAAGCAAAAACAAAAGCGGACGGAAGCTGCAGCTGCAGCTCCAAAAAGCTAAGGGTAAACACGCCG ACGTCGAGCTGGAAACTGAAACTGTGCTGAAAGCAAAGCCAAAAGCAAACGCAAAAGTCAATGACAGGCGCTCAGACAATGCAACATGCTGTCACAAAGACACTTCCGTCGCAGACGACGGCAAAGTTGTGGCTCTGATTAGCCGCCCTACGTACTGATTTTGATTTTGCCTGCGATTCTGATGCCGCGCATATCCGTTCTGGGGGAAATGGAGACGGCAGTCAGAATATATGTATCTTTCCAGAAATGTTTACTTATAGGCATAGAGGTGTGTATTTCAAGTCAACTTATTAGTAATTAGTAGGATTTTTTACTTAAATAACTTGCCCATAGAATGATGTTGAGCCAGCAGAATGTGCGGCGTATGCAAGTGTAGCCGGCATTGCCCATCGCGGGATCTGAAACGAAAAAAAAAACCATCAGGTAGAGCTCGAAACCTTTAATAGTCCTTTATATTTAGTGTAATTCCATCCTAAAAAGTATATCCTGTGGAAAAACCAGACCTTGCATCCATTAAACATCCATTTTGAAGCAGCAATTGCAATTCTGTTCGTTTATATATCAAATATAGTTTACTGTTATTATTATGTGTATTATTACTATGTTTTTTCATTGGCATTTCCTTTTGTCAGCGCCATGTAACTGGAGTACCCACATGTGTGTATGTGTGTGTGTGTGCCAGCGGGGGCGATTCGTTAGGCAATTGCAGCTGCAACTGCTGCACAAATGCAGTAATCCACAAATGTCCACACATGGGTAGACACTCGCTTATGCAAATATTTTGTATGATTGAATGAAAACAATAACTAAATAAAAAAAAATAACAAAATTAACAACAGCAGCGACCGCAATGACCATGGTCAACGAAGCAGATGAGCAAATAAATGGGTGGGTGTCCTCATCTGTATATTTAAACTATGGATGGCAAAAAGCATTCAGGGCCGTCCATTTGTC
 

Search Again