CR01536

CRIMIC CR01536

Gene CG7990

CG7990

Information

Donor Location Cytology FBti Stock number
pM37-p0X:19196058..1920197918A7-18B1Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK no band CAGTGTGACCCTGCCAACAAAGCATA CATCATTCATCAGCATCATCCTGGCC

Images

Construct Design Sequences

sgRNA sequence CGAAATGCGTGTATTTACACAGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
AGTAGTGGATGGCAACCTGC GGCGGCGCTTGTTTGTTT AATTAGGCAAGCCAGCGAGA AATAGCACCATCGACGGGAG
 
Amplicon 5' Amplicon 3'
AGTAGTGGATGGCAACCTGCTGCTCCTGCGGCTCCCTCGCATCCGCCTGCTTGGAGCTAATCGTTGTGTTGATCTGCAAGGAGTTGCAAGGAATGGAGGCCATTAGGATCGAGCGGAGTTCAAGCAAAACCACTGCGCACTATACTTGGGATGTGCGAAATGCCACATAATAACATGTGATGGAGAGTATTTGCAACATATAGCTTTTCGTTATCAATTAAATGAATTAATTAATATTAAATTGATAGTTAAAATCCACTCATTGAGTTATTAACGTATAGGTAGTAATCAGTATTAGGGTTTTTCGAGTTATCATTGAAATTAAATATTTCCCAGGACAATGTTTGCTTATGTGGCATCGTTCCAGCCCAGAACCGCAGTGGTTTCGCCTCTTAAATGGAGGAGTGGAGAATGGAATGGGATGGCAGCCCTTACCTGGCCATAGTTGGTGGTCGAGTGTTTCGTTTTGGTTAATGCACAACAACGATAAAGCGCTAAAAAAAAAATAAATAAAGGTAAAAATAGAAATGAAAACCAAACAGAAGGCGTGTGAATAAATCAATAAACAAAAGACGAACGATGGGGCGCAGCGAATTAAGGCGGAAACTATGCGATCCGGCTGAATAGTGAATGCGGTTCGCCTGGCATCCCGAACTGGATGAGCCGGAGTTATAAATAAACAAGTCCTTGAGTTCTTGGGCAGACAAGGGGAGTAGGGGGCGGGGGCAGGATATGAATGATAGCCTGGGGGGGTGGCAAGGACACTCTCTCCCCCTTTCTCACTCTCTCTCTTGCTCTTCCTCTCTTTATCGTTCTCTGGCGCTGCGAAGCAGCAAAGGATTAAGGACCAAAAATAGACGAGCCTCGCCTGACGTAACCATTATTACCAACGGCAGCTGGCCAAAATTAATTAGCTCAAGTTAATGGGAAATTGGCCGGGCGTCAGAAATGAAATTAAATATGTGCTGCGATTGAATCGGGACACCGGAAGCGAGCAGCTCGAAGCTCGCCAAGAAACTGGGCCAAAGGTGGGTGGTTGGGTGGTTGGGTGGTTCGCAAGGACATGGCGAAATCGAATAAATGATTAAAACGAGAAACAAACAAACAAGCGCCGCC AATTAGGCAAGCCAGCGAGAAAAACTAAATAAATGCGAAAACGTGTAGCAGAAATGCACGGAGAATATTTTTCATTAGCTCAATATTTTCCAAACTTCTAGAACTTAGCTGGGTTTACAAATCAAGTATTTGCAGTTCAAAAAGATTCATCCGTTATTTCATGCAGTTTACGATACATTTACAGGGATTCTCAAATATCAATTCTATTCTGTATGGCATTATATGTACTTATTGGTTATCCAATAAACTTTTGAGTTTCAGCAAGTTAGCCATTTGTGGAACACCTCTATTCCTGTAAGTGGTAAGCTTTCTTTCGGCTTTAAAGAGAGAATTGTGGTTTCGAAAGGAATATTATTAGCTTGATTACTTAGCCTTACGGAATAACTGGTGGAGTAAAAATATGTACTTGTGATTGTTTTTAAATCCACTGATTCTGTGTGCTAAATTTGGTTTCATTTTATTTTGTTGCAAAAATGGCTTTTAGCATTTCTGGATTTCTGGACTAATTTGAAAATATTTTCGGTGTGAAAAGTGTTGTGGGATGGTGGGAGGGGGTAGCAGGGGGGTGGCATGCGCGCTGACTGCGGAAAATTACAACAAACGAGCCGAGGAGGAGCATGGAAAATAAAACGTTCGCCCACACACACACACACATGTACACACGGACACACACAGTTGTTGTGCGCGTTTACAACGCTTTTTGCTGAGCAGCGGGGTGAAATGGGTGATGGTGGAGGATGATAAGGAGGAGGAGGGTTTGGGGGTGTCACTAAGCGTGCGCTGCCTCCGCTTAAAGTTATATAATTTTTGGCCAGGCCAAACAAACCATAAATACACACACTGGTTCGCACGAACACTTAAAAAAAAAAAAGAACAAGAAGAAAAAGTGGAAAGCAACAAAATTGGGCAACTCCATGGAAAAACGCCTCTCACCGCTGCTGGGTCGCTGGATCCGCCGGAGCAGCTGTTCCCGCCACCTCCCCCGCCGTCGCCAACGCACCTGGACACCAGGTCCGTCGCCCCCATCCCGCTATCTGCTGCGGATGACGTCGCCGCTCCGGTGCTCTGCTGCATTCTGTGCTCGGTTGTCGGCGTTGACGCTGGCGATGACTTTGGCTGTGGCGTTGCTGTTGCTGCTGCTGCTTCTCGTGCTCGTGCTCCCGTCGATGGTGCTATT
 

Search Again