CR01550

CRIMIC CR01550

Gene Bsg25D

CG14025

Information

Donor Location Cytology FBti Stock number
pM37-p12L:5271728..527854825D2-25D3FBti0220967

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK TTTGACACGGATTTGGAACCGTGTGG GAAGCTCTGTGATTTGGATGTGAGCC

Images

Construct Design Sequences

sgRNA sequence AACAGAGGGTGGCAGGGACAAGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TCGCGGTCATTAGTCATCCG CCTGCCACCCTCTGTTGTT GGGGATCGGCTAGCCAAAG ATCCGGCGGTCAGTTAACAG
 
Amplicon 5' Amplicon 3'
TCGCGGTCATTAGTCATCCGCAGCGTTATTTCACGCACCATGCTGGCGTGTCTTTGCTCCAGCTGCTGCACCTGCTTCTTGGAGTTATCCTCCAGCGACGCATGCCGCTCATCCACTTCCACGGCAAGCAAAGCCACCCTTTGGTTGGCCGCCTTATTATCGGCCCTCAGCTTGAGGTTCTCCTCATGCTGCTGCCTATAGGCAAGTCTGTAGTTGCCCAACTCGGTGGCCTGCAGAGCAGCCAGAGCGCGCAACATATTCGATTGCTCGTGATCCCCATCGATGCCCCGCAGCTCCTCCTCCAATGCCTTAGTTAGCTGCTGCAGGTTCACCTCCTCCTCCTCATCGAATCCCAGGACGTGAAGTAGGTTGCGAGTGTTGGGAATGCTGGCCAGCTCCCAGGCTTCCATAATGCTATGCACTGAGATCGTCTCCAATTGCTGCGGCGTCACGGTGTCTGTAAATCATGGCAATTAACAATTAGCGTGGGACGAATGAGATTGGCTTCGCTGTTGTATATACACATTTATTATACATATAGCCCAAGATACCAGGTGGGTGTGGGATTGGATTGGGATTGGGAGTGGGGAAGGGTGTGTGTGTGTGTCGATGGTGTAAGCAAAAGCGCCGAAAGTTTGTTATTTCTCTATATCAAATGGCTTTTCGAAATGAGAAATTTTTGGCGTGTTATTTTAAGAGGTAGAAACTAATAAATCAAGAAAATAGAACAAATTATAAGTAAATATCCTTTCTAACTGAAATTGATTTATATGAAATCCTTAATTAAATTGATTGTCAATGCATTACAGCATTACTAAGGGTTGAAAATGTAGGATATGTGATTATACGAGTAAATAGAACGAATCAAATGTGCGGCTACATAGGGTGCGATTAGATACCGAATGACTGGGTTGGGGATTCGGTGGGTGTGAGGGTGTTGACAATTGCTTCAGAGCGCACAAACCTTTGCAGCATGACCAACGGCCGCCGTGGTAGCATCTCCAGTGCTCGGACGACGGTGCGGGATTGGTGGCCAGGCGATGGCCTACGGTGTGTACCGACAAACAAGTGTTTTGCTTTTAACATTGCTTCAAACGTAATTTTGGCATTTTGGGCTAACAACAACAGAGGGTGGCAGG GGGGATCGGCTAGCCAAAGCTGGTCTGGCCAGAGGAAACTTACCCAGTGATTCCACGCTGCTGCTGTGCTGCGCCTGGCTCTGGATGGAAAGCTGTTTCAACTTGGCCGCTGCCGTCGGTGATGTAGTGGCTCCCGTGGTGTTGCTGTTCATCTTCCGGCGTGCTGGCAGTGAAGCACAACGCTTCAGTTTGCTCCCGCTGGTGTGGACGGACCGCAGACGCCGGCTGCCAGGAAGATCGCTCTGGGACGAGGAACGTTGCACCTGTGTGGTTTGGAAAAATAAGATGCTTATGATGATCATGATGTATATTTAAGATAATTTGTTTGCTTTGGTAGTGCTACTTAGGCATGCTCTACTGTATCAGCAATAATAACGATTAAACAAAATCTGTTTACTATGCAATTTTGCATACATAACCAGAAGTTGTATCGCCACTTCGTACGTGACTTGACAAACGACACTCACCTGAACTCCCAGCTCATCGCATCCGTTGAGGCTTCGCTGATTTTGCTGCTGCTGCAACTGGTCCTCGTCCGTATTGTCCGAGTCCGTGACGGATAACTCGTAGATTCCCTGCTGTGGCCTAGACCGGCGACCGTATTTCTTGGTGCCCACGACGAGTTTGGGTGAAACCTCGCGATCGGAAGACTCCGGCGGACTCTCGATGTATGTGTTGTTTAGCGGCTCATCCGTAATCACCAGTGAACGCTCTGGAAGATTCAATAGATATAAGTTAGCAGAGAACTGGAAGAGTTGTATGGATCTTAGGTGGCTACCAAAACGAGCGGCTAGCTTCTCAATTATCGGATCTGTTAACTGACCGCCGGAT
 

Search Again