CR01562

CRIMIC CR01562

Gene gus

CG2944

Information

Donor Location Cytology FBti Stock number
pM37-p12R:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band no band AGAGTGGGCGTGGCAAATGGATAGAA TCTATGTCCTCAGGCCTTTTGCCT

Images

Construct Design Sequences

sgRNA sequence ACTGTTGACGGTTCCTCATCCGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TCCTCCAAGTTTGTGCGACC CGGGTAGCATTGTACCCCTC ATCGACAGTATCCGGTCAGC TGCACAAGTGAGTAGGTCGA
 
Amplicon 5' Amplicon 3'
TCCTCCAAGTTTGTGCGACCAATTTTTTGACGAATTGTTCTTCGGCAAAGATCCATTAGGGGCAAGGGTTCGGCTTAAAAGATACAAGTAAGAAATTGTTTGTTTTTTTGTAAAAATATATATAATTTTTTAATAAGTGTCATGCGAACTCTAAATAATTAATGTACTTTTCGCAATGTAATCATGTAATCCACAATTTATTTAAAACTTAAGAGAGTGCTATAGTCGAGTGCCCCGACTATCAGATACCCATTACTCAGCTAATGGAAAGCCGAATGTGAAAGTTTAACAGTTTTCTGACATTGGGGCATAAAATGAGAAAAAAATTAAAAATAGTTCAAAAACGTGGGCGTGAGCCTTCTGGGCGTATGTAGAAACCGATAGAAATTGGTAAGACAACCAATAAAACGAAGAAAAATTAAAATATTTTTCAAAAGTGTGGGTGTGACAGTTTTCGGCGATATGTGGGCATTAGAGTGGGCGTGGCAAAACGTTTTTGAGAACTCAATAGTAAATTATAAGACAAATAAGAAAAGGTCGGCTTGTATACGTGGCAACATCAGTTAATATCAGTTCCGCTGCGTCTAGGTTTCTGGAATCTGCATGCCTACTCTGCCTACACCTTGGAGTTGGAGTCACACTTACCCAAAATGTGAACTTTAAAGGGAAACCACAAATCACGATTGCAGACTCTAAGGTGCTATAAACTTCATGTTAACGCCACAGCGCTCATACGAAAAGTAACATCATTCACAACATTCACAACCTCCAAAAGCAAGTCAGAGGGGTACAATGCTACCCG ATCGACAGTATCCGGTCAGCCGAGCAACGCATTCCGCATCGGCAAAATCAATATGAAACGGTCAGCCATGAGTCACGAAGCTCCAACTCGCACAAAATGGCACGAGGCGCTGAGAAAGCGCTCTGCCAGGATCTCTGCCCTCAACGGAAGACTTCGCGGGATAAATATGTTAACTCTATAAGTTAGTACGTTCGAAACCAAAAACAAGAAAAAGTTTGCTCAATAAATAACCCTTTTATTATAATAACCTACATGGTTTAATTTATATCTTAAGTAATGGAAATTGCGATAGGTTGACTCTTGAAACATGACACAATTTGGGAAGCGCTGGCAATTAAAACCGAAGTTCTGGAAGACTACTTGAATATTTATATGTGTATGTAGCCCTCTCATCCATACTTGTGGATGCGCACGCTATTCCACCGAACTTAAGAACAAATGCTATATCTCCCATCTTCAAAGCAAGTACAGAAATGTCGTCTTTCAACTCTGTATAGAAACATATCGTAAGACACTCAGAATTTCCTGGAAAAATCTTGTTTCCTCAAGGAGGTCCGAACACGGACTATCCCAAACGCACGCTAAATAAGATAACGAGGTTATTCTACTACTAAACAACACGGTCTTGACCGAACTGGGCGTGACCGGTTTGGGCGTTTTGTAGGTGAAAGGAGGGGAGAGGCTACAGTGTTTTTGGTATACGAATAAAAAATGGCAACACAAACAATAAATCGATAAAAACAAGAGAGAATGCTATAGTAGAGTTCCCCGACTATCAGATACCCGTTTTTAAGCTAGTGTGAGAATGGGAACGAGAAATTTCATCGGTTTTTCTGGGATATCGATAGATATTAGGCAGTAAAATGAGAAAACAAATTTCAAATATGTGTGTATAAAAAGTTTTTTGGCACATCTATAGAAAATTACATTAGTTGCGCTGCGTATTTGTCTCTAGAATCTGTATGCTCAAACTCAACCTTCTAGCTTTTATAATACGTATAATTTATATGGTCAAGAAATGTAGTATACCCTTTTACTCTACAAGTAACGGGTATAAAAATAAATACTACTACTATGCATGTTTACGTCCATTGGCTTTGAAACTATCCGATATTACTTTTCTTACACTAAGCACAATTCATCTTTTAATATTGGTCTTGCAAAAAAACCTTGCAAAATCGACCTACTCACTTGTGCA
 

Search Again