CR01571

CRIMIC CR01571

Gene Hdc

CG3454

Information

Donor Location Cytology FBti Stock number
pM37-p12R:10242399..1024241646F7Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band OK TGAGGCGATTGCACCATGGACTTCAA ATGTTCATCTCCTCCAGCACAGTGGA

Images

Construct Design Sequences

sgRNA sequence TTAAACAATGAAGTTGGCTATGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TTCGAGCTTACATGGCTGCT GCGTGCCGACCAAGAGATA TCATTGTTTAAGCCGCTTACAGT CACTGCCACTCCGGAATTCT
 
Amplicon 5' Amplicon 3'
TTCGAGCTTACATGGCTGCTTTTGTTTAAAGCGTGTGGCAATTATTTATTAGATACTTTAGCTGAACAACTAAATAATTGCAATTGTAAGTTAATTACACACACGTGGTTAACATAATCTACGAATTGTTAGTATATTACATCTATATCCCTTTTGGTTTTATTAACACTTTAACACCTTTCCTAGTCATTAATAATTGTGTACTTTTATTCTAATTAAAATAATTAAATATTTTAAAAAATATTCTATATTAATTAGGGACAAAGACTAAGCAAAATCGCTTGAACTGTATTAAAGTACATTTTATTTACAGGCAAGGAGATGGTCGACTATATTGCAGACTATTTGGAGAACATCCGGGAACGCCGAGTTTTTCCGGATGTCAGTCCGGGCTATATGCGCCAGTTACTGCCGGAGTCCGCTCCGATCGAAGGTGAACCGTGGCCGAAAATATTCTCGGATGTGGAGCGAATCGTGATGCCGGGCATAACCCACTGGCAATCGCCCCACATGCACGCCTACTTTCCGGCCCTCAACTCCATGCCTTCCCTACTGGGCGACATGCTGGCGGATGCGATTAACTGCCTGGGATTCACCTGGGCGAGCTCGCCGGCCTGCACCGAGCTGGAGATCATAGTGATGAACTGGCTGGGCAAGATGATCGGTCTGCCGGATGCCTTTCTCCACCTGAGCTCCCAAAGTCAGGGCGGTGGAGTGCTGCAGACCACTGCCAGTGAAGCTACTCTAGTTTGTCTGCTGGCGGGACGGACTCGGGCTATTCAGCGATTCCATGAGCGACATCCTGGCTATCAGGATGCGGAGATCAACGCCCGGCTGGTGGCCTACTGCTCCGATCAGGCGCACTCCAGTGTGGAGAAGGCGGCGCTCATTGGTGGGTTTAATCTAACTAACTTTATAGTTATTGATTGTTAGGTGATCCTTTAGTTTGATTACATTCCCTTATAGAGAAAACCATTTACACTAATACACCGAAATACGTATGATCCACATTTGCAACTATTCTATCTCTTGGTCGGCACGC TCATTGTTTAAGCCGCTTACAGTTTAAGCCACACTCCCACTCTTTTGCTCCGCAGGACTCGTGAGGATGCGTTACATCGAGGCGGATGATGACCTGGCGATGCGCGGCAAACTGTTGCGCGAGGCCATCGAGGATGACATTAAGCAGGGCCTGGTCCCCTTCTGGGTGAGTGGCAGTCTGTCAAAATTAATTGGCTCGCCTTCCGCAGCCAGCTGATTCCCCATTCTTGATTCCTAACTCCCAACTGGAAACGCCAGATTCACGACTCCCACTGGAGCCAATTAATACATGTCAGCATTTAAGTGTCCTGCGGTGGTTTATTTTTAGGTCTGCGCCACACTCGGGACCACCGGCAGCTGCAGCTTCGATAACCTGGAGGAGGTGGGTGCTTAGGGAATAATTACAAGAAAATAGGAATAATCCAATGGCCTAAATTAAGTGGCCTCGAAACATCTGCCAGTGATAAACAAAGCTATAATTTATATAAAGGATAATATATTGTTCCACTAGTTTATTGTACAAAGCTTAAAGTAAATCGTTTTGAAGAGGCCATTTTTTTAGTAGGGAATAACAAGGATACTCCTTTAAAGGTCATATACTTCGTTTGTTCGTAACAAAAGTATTTTAAAGTGATTGAATTGAATTTAAATGAATTTAATAGTTAACAAATTGAAGTAATTAACTATTATTACGCATAGTTTTGGCCCAAAATAAATAATTTAACATTTGTTCTCTTAGATTGGCATCGTTTGTGCGGAGCACCACCTGTGGCTCCACGTGGACGCCGCGTACGCCGGCAGCGCCTTCATCTGCCCGGAGTTTCGCACCTGGCTGCGTGGCATTGAGCGGGCGGATTCGATAGCCTTCAATCCGTCAAAGTGGCTGATGGTGCACTTCGATGCGACCGCATTGTGGGTACGGGATAGCACCGCCGTCCACAGGACCTTCAATGTGGAGCCGCTGTATCTGCAGCACGAGAATTCCGGAGTGGCAGTG
 

Search Again