CR01591

CRIMIC CR01591

Gene CG9650

CG9650

Information

Donor Location Cytology FBti Stock number
pM37-p1X:7234417..72344187A4Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band no band AAGGTCAAGCAGGAACCCTACGATGA GGTTTGGCACGTTCTGATTCTGTCAG

Images

Construct Design Sequences

sgRNA sequence CATCTGTGTGACTTGTCAGTTGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
CATGGCGCATATTTGGGTGG AGTTGGCATTGTCAGAGTCA GACAAGTCACACAGATGCAC GCAAATTGACCGCCAGGAAG
 
Amplicon 5' Amplicon 3'
CATGGCGCATATTTGGGTGGCAAAATTAAAATTCCCTCCAAAGCAGAAGCAGGGTCGAATAAAAAATGTGTTTGATGTGATGATCGGGCCGCGGGCCCTCGGCGATAAGCTGCAGCTGCATTAAATAAAAAAAAACACCGAACGAAACCAAACCGAAAACCGAACCATGGCAAACCCAAACCCCTGGTTCTTCTTCAGGGGCAATGGGCTAAGAAAAAAGTACACATAAATAATAATACGGGGAAAAAAGCGCGGACACTGCGGGCTGTGGACTATGGACAACGGAATATGGAGTCCGGACAGCGGACTGCGGACTTCAAAGCGCAGCTCTCAATGCTGATAAACTGCAGCGGCTGTGGCAGTGGCAGCAGGACGAAAAAGGACACTCGGACAGCGGCGACAATCGAAGCCCCGACTCTCTACTTCTCTCTCTCTGTGTGTCGTTCTCTTTCCCTGGCCTTTGACTTTGACATTTCAATGCAAATGATGATGAAAAGCCAAAGACAGCAATACAAAAAAACAAGCAAGGACTATGGCAACGGTTAAGGGTAACCAGGCAGGACAATAAAGCCGCAGCTCTGCAGCGCTGTAGCTCGGAAGCTGCCCTCGAGGGTAATTTGAATGCCTCAAAAACAGCAGCTAAGGAATGCCAAAGGGGGTGAAAGGCCACTTGACTGGACAAAGGACATCGCACTGGACTTGACACACGCACAAAAGCGGGCCAAAACAACAAGGGATATTTAAGGGAATAAAAAACAAAATAAAATAAATATAAGTACAAGAATTCCCTCTACTTGAACTCACTGAAAGAGGTGCCCTGTCCGTTGCTTTTTGTTGTTGTCGCTGTTGTTTGTTAACTGCCCAAGAGAGGTCAGCATATGAAATCATCGCGAAGGTCGTGTGTCAGCCGAAAAGCGATTGACTCACAACATCAAATTGGCCTTAAAAATTGGGATGAATATATATCGCGATATATAGATAGACAGAAACAATAGATAGCTAGGGGGGGAAAGGCACAAGCTACACATACGCCATTTAACCCTTGAACTTTTGCGCTTTTGACACGAACAGCGAACAACAAAAGTCACTGACAATACGGCAAAAAGTTGTTTGACTCTGACAATGCCAACT GACAAGTCACACAGATGCACAGATATATAGATACAGATCCAGATACATCTGGAAATACAGATACACAGATACAACTCGCACAGAGCTGCGTTAATTACGCATTGTTCTGCCTTTTTTCTCTTTTTTTTTCCTTTCGTTTTTTGTTTTTTTTTTTTTCTGTTCTGTTCTGTACTTTACTTTACTGGGCTGTCCAACCTAACTCCTTCCATTTGGGCCATTGTTGGCCATTTGGTAATTATAAATACGCCATGGCAACCAACCAGGCAGCCACAGTGCTCGTTGAATAAAAGAAAGCCAACTGTCAACAAAATGGATATTTGTTGCAAAAATGTAAATGCAACATGTCCTTGCCACAGGACTTTTCACCTGTCAGCGCGCCGTGTTAATTATCAATTTCGAGGCTCAGCATGTCGCGACCGCAGCGACAATGAAACCCCATCAAGGGTTAAGGGTTAAGGGGTTAAGGGTCACAGCTCAGATGGGGCGGGTGGGTTATGGCTCAGACCGCAATTATTGACTCATGCTGGCACTGAGCCAAAAAGAAAAAAAAAAAACAGTAGATAAGAGAAGAGGAGAGGAGAGAAAGCTGAGTGTATAAAACACCAGCGAATGGTCGAGTGGTCGAAATCAATGGCTAATGCCTTCGGTTCATGCAACTCCACGTCCTGCGGAGGATTAGAAGTCGCCCGGTGGTGTCCCACGTCCTTTTTTGTCCTTTGTGCGGAAAAAGCCGGAAAAGGATTCACACAGACCGACTGGCTGGCTTAGGATGCTGACAGTTGGCGAAGCTGCAACAATTATCCCATTACGCGCGCAACCCTTTCATTTTCTGATCGCCACCCGCTGGTAAAATCGCTCATACGCACTGTGAGACGAGTGCACTTCCTGGCGGTCAATTTGC
 

Search Again