CR01679

CRIMIC CR01679

Gene Gyg

CG44244

Information

Donor Location Cytology FBti Stock number
pM37-p02R:21200483..2121082157D1Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band long band CAGTTGGAGATCTGCACACACCACTT CTTCTGCTGCTGGTAGAACTCATGCT

Images

Construct Design Sequences

sgRNA sequence GGAAGACATAAGATCATTTGGGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GGTGACGCTGACGACAAATG GCACCAAGTAACGCTGGAA TCCCTTGTTTTTGAACGCCAG CGAATGCGTGCTAGTGTGTG
 
Amplicon 5' Amplicon 3'
GGTGACGCTGACGACAAATGACACGTACTCACTGGGTGCCTTGGTCTTGGCCCACTCACTGAAAAGGGCCAAGACCGCCCACCAGCTGGCCGTTCTGGTCACGCCCAATGTCTCGCAGGCGATGCGCGACCGACTGAAGGAGGTCTACAATGTGGTGCAGGAGGTCAATGTGCTCGACTCACAGGATGCCGCCAATCTGGCGCTCCTCTCGCGACCCGAACTAGGCGTGACCTTCACAAAACTCCACTGCTGGCGCCTCGTTCAGTTTGAGAAGTGCGTCTTCCTGGATGCGGACACACTGGTAAGATATGAAGTATTCCAAGGGCACAACATGTAACTTGTGAGCTAACAAAGACTTAAATAACTACTTTCAATTTGATTTCGTAGGTCTTGCAAAACTGCGATGAGCTCTTCGAGCGCGAGGAACTGTCGGCTGCTCCGGATGTCAGCTGGCCGGATTGCTTCAATTCCGGCGTGTTTGTGTTCAAACCTAGCGTGGACACCTTTGCCCAGATCACAGAGTTTGCCGTGAAGAATGGCAGCTTCGATGGCGGTGACCAGGGTCTGCTGAATCAGTTCTTTGCCGACTGGTCGACGGCGGACATTAAGAAGCATTTGCCATTTGTGTACAATGTGACGGCTTATGCCTCGTACTGTTATCTGCCCGCCTTCAAACAGTAAGTTCGCTATCTCTGTGGAATGGAAAAGCAGTTTGTAATGGCATTTGTTTGCTTGCAGGTTCAGAGATAAGATTAAGATTTTGCATTTTGCCGGCAAGCTGAAGCCCTGGCTGATTCAGTTCAACTCGGAAACAAAGGTGGCCAGCGTTTCGTCGGAGTATGCTCATGCCCAGGATTTGATTCAGCTGTGGTGGAACATCTTTTGCGAAAATGTCATCCAGTCCCTGTCCACCGAAATGGTAAGTGCTATTTATACAATGGATAACGCACATTTTGGAAATTTCCAGCGTTACTTGGTGC TCCCTTGTTTTTGAACGCCAGACTGAAGCTAACCCTTTGATTTTTACTGTCTAACCCAATGTATTTGCTCCAAATCTCAAAAACAAAAAACCCTGCTTCGTTTTCTAACACGCTAATCGCAAGCAAACGCCAGGAAATGTTGCTAGTGATCGACCCGCGGGAGAAATGGCCCAAGGGTCCACTACTTTAGAGGTAAGCAGATCTTCAATTGCCGAATCGCACATATCGCACCAGATCTGTAGATACCTTGAGCACAGCCCTGTGTAAATATCTTAATTATAACTTAAATATTTATTTATTTATTTAGCTAACGATTCAGTCATCTTTCTGTGCGCCAAGTAAATAACCCAAGCAAACAAACTCAATTTCGATCTATTTGCCATTTGTTTTTTGCCGATAGCTGGCCTCGATATCGTTTCATTTCCCGCCTCTTTTCTATCAACTCGGTTTGAATATACTTTGTTTTCGTTTTATTTATTTTTATTTTTTTGTATTGGTTTGCAATTTTCTGTTGATTTTTTCTCGATTAGCAGCCACGCCCCAGAGTAACCCATTTTCCTTTTTTTTGTATATTTTCTTTCACTTTTTTGGCACCATAGGCAGACCAATTCTCAATTTATTTCTTCTGTATTTTTTCTGTAATATTTGTGCAACTGTGTGTGTCTCTCGTGTGTGTGTGTGTGTGTGAGTGCTCGTCTTAGTGTTCACTTTCTTTCTGTTTTCTTTTCCTTTCTAATTTGCATCGATTTGGCAAAGAGCCAGGAAAATGTTTCGGTTTACGCCATCGATAGATGGAAATGATTCAAATCAAGATGGTCGGTTGCGGGTGATGCCAAAAAAAAAACTCAACTGAATCATTAGATATATCCCATAACACAAACAAACACACACACACACACACTAGCACGCATTCG
 

Search Again