CR01718

CRIMIC CR01718

Gene CG6282

CG6282

Information

Donor Location Cytology FBti Stock number
pM37-p03L:8604657..861707466D8Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band no band AGTGGCACACACAGACAGCACTTTGA CACAAGCAATGGCAGCACTTCCGTTT

Images

Construct Design Sequences

sgRNA sequence GCTGAAATGTGCGCCTCGATGGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
GACAAGCTGACGGACTTTGC CGGAGTGGGCGTAACCTTTT TTGTTCGTCGTTGTTCCGT GATTTACCAGCACACGCGTG
 
Amplicon 5' Amplicon 3'
GACAAGCTGACGGACTTTGCCGGCGGCGTTAACTTCATCATCATCTCCCTGCTCACTTTCTTTCTCGGCCAAATCGATCGTCCATCGAAGGTAGGTCTAAAATGACTATCTTATTGCAGTTTTATAATAGAATTTAAGTATATTAATTAAAAAGTTTGCGGGCCAAAAAAAACTAGTAGTTATATCGCTTTGTATCTTTCTTTGACATTATAATTTTAATTAATTTCTTATGAATTCATTAATTTTCAAGTTTACTCGGGCTATATTTTAAATAAAACATTTTAGTACCACACTATCTAAAGTAAAAAAGAAACAATATTATCTTTCCTGCTGCAACAATTGATGCATTTTTGCGCAATAAATTATTGAACATCAAAAACATAATAGATTGGTCATTATTTAATTTTGTGCGAAAAAATTGTTATTATTAAAAATGCCAATAATAAATCTCCAATGACTGCAAACCAATTTCGGTGAAAAAATTGCTTTGAATTGCATTCCAATTAAAAGCTGAATATATATTACATTTGATATGTGCGTAATTTATTGCTATAGTTCAATTCTGAACAATGCATAATTTATGTGCAATTTGCTTTATTTTGTTTAATAGCTCGTTGGTTTTCATTGTGCGTTACTTTTTGTGTTAGCAAAATTAAATTCTGTGAACTTGAAGCGTGTCCATAAACAAGTCACCCAACTGGGCGTAAAGTGGGTGTTGGTTTGGTTTTGGGCCCTAGTGGTTTCGGCTGCTGACATTGAAAACTGAGTTTTGCATACGCACACACAGCCACAGACGCATATACAGACACAGATACAGACATCAACGCACACAGACGCAAACATCCAATGCCGACAAACAAAAGGTTACGCCCACTCCG TTGTTCGTCGTTGTTCCGTTTGTTGTTTCTGTTTTATTTGTAGTTGCTGTAGCTGGTAACTGGTAGTTGGTAACTGGTGGTTGGATGCAGCTGGCACATGCATAGGTCTCCTTCTGGCTGGGCATGACCTTGGCATCGTGAGGGTCCTCAATCCGTCTGTCGGCGTGTCCTTCCGCCGGGCTAACACGATGCCTAAGCAGCTAACTAAGGCTATTTGCGGCCGAAAACAGCTCGAATCCGCTCAAAAGCGAAAGCCAGCCGATTGAACTCCCCAGCCTAAGCCAGTTGGTCCATTGATTAATCCAAATTGATGGCCAATTTCGCTGTTTTCCCGCTCATTAGCACGGCAGTAAAGAGGAAAATTATGTTCACCTTAATTAGTGTCTGCACGCAATTACAAAGTGCGTATGTATGTATGTGTAGCACAGCTTTTAAGGTAAAAATACTTTAAGCCACTGGAAATATCAGTTCTTACCTGCAATGGTCTTAATTAAAGTTAAAATATTTAACAAGGTTTTAATTAAGATTGCTCCAATTATCAAGTGAAATATGAGATGCGAAATTATTTTGGTTTCAATTTTCACTGTTCATTAAAGGCGGCTATCTGCTTCATTATCCTGTTTATCTAGATCCTCTTATTTTAATGAATATGAGGCCTACTTGGCGAGCTCAGTAAGGATATATCTGTGATATTAATAAAATATGATACGCTTGAAGGGACGTCAATAAACAAAGACCTTAAAAGCTTTTCGTTCGGTTTTCAGTTTTAAACGCCACCCAATGTATCGATTTGTTGGCCTGGCCCATGGAAAGCTGGTTAAGGGCTTTAAGCAATTTGGCCATGACAACAAATACAAATTGAGAAATAAATTCATTCTTATCTGCTGTTGGTTTTTGTTGACCAAACACACGCGTGTGCTGGTAAATC
 

Search Again