CR01722

CRIMIC CR01722

Gene CG6083

CG6083

Information

Donor Location Cytology FBti Stock number
pM37-p03L:11624528..1162612568C15Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band long band TGCCTGGTAGTTGGAGTCGAACATAG CCCACCAACTCAAAGGCTACAATTCG

Images

Construct Design Sequences

sgRNA sequence GTCAATGTCAAAGCTCTTCGGGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
AGAGCAACACCTACGCCTTC CGGGGTCAAGCAAAAGCT AGAGCTTTGACATTGACCGTG TTCATCATGCCCAGACGCTT
 
Amplicon 5' Amplicon 3'
AGAGCAACACCTACGCCTTCATGGTCATAAAACGCCCATTGCAGTCCAATTCGTTAATGGCCTGTATGTCATCGACGGCCAACTCAAAGTCCCAGATTCGCTTAAAGTTGTCCAACATGTGCTGTTTGCTTACTGATCTTGGGATGACAATTATACCCGATTGTGTCTGAAAGCGTAGGAGCACCTGTGCCGCAGTCCTTTCGTATTTCTCAGCTATAGCCAAGATGGTCGGATGCTGGAGCAGTGGATAAGCGCCGGGCTTCTCGTAGGGCGTATGTCCCGATCCCAGGCAGCTGTAGGCGGTCACAGCAATGGCATTGTCATAGCACAGCGTAATCAATGGCTTCTGACTAAGGTACGGGTGGCACTCGATTTGAAGAACTACCGGTTTAAGCTTGGCCACACTGAGAAGTCTATTCATCTGCTGCTCATTGAAGTTAGACACACCGATGGCCTGGCACAGACCCTCGTCCACCAGATTCTCCATTGCACGCCACGTGTCCACATAGTCGATGTCCTCGAATGCGGCCTTATTGGTGTCCGGACACGTGGGATATAGGTTGTCACTGCCCGACTTGTAGGCCATGGGCCAGTGCATCAGGTAGAGGTTTAGGTACTTGACTCCCAAGTTCCTTATGCTTGTCTCACATGCCGGGCGCACCAAATCCGGCTTGTGGTGTGTGTTCCAAAGTTTGCTCGTGATGAAGAGTTCATCTCTGCAGTGCAATATGTATTTATGGCTTAGATAAACGATTGATTAGGCCTGAAAGCAGCACTTACCGTGTGACCACTCCCTCGTCCATTTTCTCCCGGAGAGCAGCTCCCACTTGCGCCTCATTGCCATAGATATGAGCGCAGTCAAAATGGCGATAGCCTATATCAATAGCATCCTTTACTGCTTGGGTCACCACTTCCGGCGGGCTCTAAAATGGCGAATAAAACGTAAAAAGCTGAGGTGCATCAAAAGCTTTTGCTTGACCCCG AGAGCTTTGACATTGACCGTGAAATATGCAGTGGAAATGCACATTTCAGCTGGCTATTATTTAATAACAATATATATCTATGTAAAAGTACTTACCCGCCAAGTTCCGAGACCCAACATAGGCATATTTTTACCATTGCTCAAGAGAAAATTCGGTGTCGACATGTTTGAATCCTTTTGCTCCTTGTGAAATATGTTGTTGCACTGGCTTCGTTTTTGGAAAGCTTTAATTTGTAATTTACTAAGTGAACTATACTCAAAGGCCTATTAAACTGGCTAGAAACAGCATGTCTTGTGACAGCTCTGCTATCACAACTATATGTACGAAAATTGTTTAAATTTAGAATCTTTTGGGCAAGCAAAAGACCTTCGCGGAATATAATCGATTCGCTGCAGAGGGAAATTTTAAAATTTAAAACAAAAAACTCTTTTTCTGCGTTCAGAGTTTTATTTTATAAACCGAGTATAATGTAAATAAATACCTTTTTTTAATAAAATAAAATAAAATGTTAAAAAAAAAACTTTTGAAAAAATATTCTTTGTATTATCGCGTTATAAAAAACAAAGACAATCGATAGAAGTTTCCGATGAAAACATCGCATTCGCAGATAGTGCCTGACCTACCATCTCTAATTTTGCCGCCTGCGAAAAACACAAACAATGTTCGGCACCGTAAATAACTATTTATCCGGCGTTTTGCACGCCGCCCAGGATTTAGATGGCGAGTCCTTGGCCACGTATCTCTCCTTACGAGACGTGCACGTTCAGAACCACAATTTGTACATTGCCCAGCCGGAAAAGTTGGTGGATCGATTCCTGAAACCGCCACTGGACGAAGTTGTGTCCGCCCACCTGAAGGTGCTGTATCACCTGGCACAGGAGCCTCCTGGTTACATGGAAGCCTACACCCAACAGTCGGCAGCCTGCGGAGCCGTTGTGAGGCTTTTGCAGCAGCTGAAGGACGAGAATTGGTGCCTGCCACTAATGTACCGCGTGTGCCTGGATCTAAGGTACTTGGCGCAGGCCTGCGAGAAGCATTGTCAAGGATTCACACCTGGCCACGTATTGGAGAAGGCTGCCGACTGCATAATGGCCTGTTTCCGCGTTTGTGCCGCTGATGGACGAGCTTCAGAGGAGGACACCAAGCGTCTGGGCATGATGAA
 

Search Again