CR01763

CRIMIC CR01763

Gene Cds

CG7962

Information

Donor Location Cytology FBti Stock number
pM37-p03L:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK no band CACGACCAGCACCTTGGACTTCTTT TTGGCACACAGGACATTGTCATGCGT

Images

Construct Design Sequences

sgRNA sequence AGGGTTTAAATACTTTCTATTGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
ACACTGCATGCTGGGCTAAT CGCCGAGCAAAGTCCATGAT GCACTCCGGTCGTATCGAAT CGAAGGAAAGGAACCGGTGA
 
Amplicon 5' Amplicon 3'
ACACTGCATGCTGGGCTAATCAGAAATAGAGAAAAGCATTTTAATTCGGACGAAGTCGACATACGGATCACGCAGCACGGGTCACGGCAAACGGCAAACGCGGAGAGCGGAACACGGACGAGAACTGCTCAAGCGGAATCAATAGGAATCAATACATTGTGAATAGATCTGGCGAACATCGAATAATGGCCGAAGTGCGACGCAGGAAGGGCGAGGATGAGCCACTGGAGGACACGGCCATCTCCGGATCTGACGCAGCCAATAAGCGCAACTCCGCCGCCGACTCCTCGGACCATGTAAGTAGCAATGACTTGTATGTGGAGCAGCCGAGCGGCAGCTGTTCCGGACACCAATTTGCATAATTCTTGGAGCATAGAAAAGCCAATGTGTGTATACCAACAAATGTGTGTGGCTATGTGTTTTTGTTATTCTCTGACGCACAAGCAGGTGGGAGAAAGAAGAGAGAGCTCTCTCCTGGAGAAAATCCAATAACAAACACAAAACACACCACTAGCCAGCCAGCCTGCCTGCCACCCAACCACCCACCTGCTGTGTTGCAATATAGCGCCATTATGACCAGCAAATCCAATTAGATGGACTACGCCAATTAGGGAAGCACTGGGCCAAGAACCCAGAGCCGAAACCATTACCATGACCAGACTCCCTTTCTGGCTTGGACTTTTTTTGTTATTGCTGGGTGATAATGCCTCCTTATCAACCAAGCTATTTGGCAACAAAACACGCCACCCAAAAAAACCCGCAATTTTTCTCCCCACTTGGTTCCCCTCTCTATTTTATGTGCCTGTGTATTGGATAAACGAGTGATTCTGATTATGGGTATATAGGCACATACATACACGTATCATGGACTTTGCTCGGCG GCACTCCGGTCGTATCGAATCTGATAGGAAACCTACTTTGCAGTCCCAGCCAATGCAATCAATAAGTGAATTTTCCCTTTCCCTTGCTCCTCCTCCTGCCAGGTGGACTCCGAGGAAGAGAAGATTCCCGAGGAGAAGTTCGTCGACGAACTGGCCAAGAATCTGCCGCAGGGAACCGACAAAACGCCCGAGATATTGGACTCGGCCCTCAAGGATCTGCCGGATAGGTATGTGAAACAAATCCATATGCGTAGTTGGGATCTTTAAAGATCATGATGAATAGCTAAAGGTCGATTTGGAATTGATGATTCAAAAAATATTTTATTGAAGTGCGAATTTTATAAATCCGACAGAATGAGTATGAGTGCGTTCCAAAAATAATCCATATCCACAGCTGTCTACAGTTGGCGAGCAAATATTAAAAGTAAATATGTACAATTACAAACAATTATTTTTTGCGCATTCCACAGATGGAAGAACTGGGTGATTCGCGGCATCTTCACATGGATTATGATCTGCGGCTTCGCATTGATCATCTATGGTGGACCGCTGGCCTTGATGATCACGGTAGGTTTAATGGAATTCGCTTAAACGAGTCTTCAAATAATCGTTGTCCTACTTTCTCTTTGCAGACGTTACTGGTGCAGGTGAAGTGCTTCCAGGAGATCATCTCGATTGGCTACCAGGTTTATCGAATTCATGGCTTGCCCTGGTTCCGAAGCCTTTCCTGGTATTTCCTGCTTACCTCAAATTACTTCTTTTACGGAGAGAATCTGGTAGACTACTTTGGCGTTGTAATTAATCGGGTGGTCAGTAAATAATACAATAACCTGATTATATCGCCTGGTAAATATGCAATTTCATCTACAGGAATATCTGAAGTTCCTGGTGACCTATCACCGGTTCCTTTCCTTCG
 

Search Again