CR02153

CRIMIC CR02153

Gene pasha

CG1800

Information

Donor Location Cytology FBti Stock number
PM37_p1 3R:31617977..31622217100D1FBti0216172 Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK AGCCTGGTCACACTGTCTTGCACTAA ACAGACAGATCGCTCTGCGCTTTCTT

Images

Construct Design Sequences

sgRNA sequence AAAACCAGCCGCGAAGTTGATGG
sgRNA2 sequence
 

Search Again