CR02295

CRIMIC CR02295

Gene CG13198

CG13198

Information

Donor Location Cytology FBti Stock number
int200_PM37_p02R:11654898..1165576248B5Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band no band TTCGCTGAAGGTCAGCCTGTTTCA GCTCCTAACTTACGCAATCTAGGC

Images

Construct Design Sequences

sgRNA sequence TTAAAAATCACGAGTGTCTGCGG
sgRNA2 sequence
 
left_200bp right_200bp
AGTAACTTTAATCAAACGTGTCCTTGGAAGGAGGTAAGTGAATAAGGAATTCTTTGTAATCTGGCACATCTTTTTTTGAAGAACTAAAGATTCTATCAGTCTAAAGTTGTAATGGTATTTCGATAAGAGGTTAATGTTTTAGTTTCATCCGGCTTTTAACGCTTCATTGCAGAACAGAAATTTTTAAAAATCACGAGTGT CTGCGGTTAACTGCATTGTAATGAATATGAATAGAATTTACTCGACATAATCGACTTCCCTTTGACTTGCGCCCTTTATCACTCCATATTGTTCCAGAATCACATGACGGTGGAGAAGTTCGCCCTGGATTTCACAAAGATCAGCATGCCGGTGCCCGCGGGAACCTACCGCTTGGGTTTCACCTTTTACGCGTACGGCA
 

Search Again