CR02705

CRIMIC CR02705

Gene CG1545

CG1545

Information

Donor Location Cytology FBti Stock number
int200_PM37_p1X:0..0

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK TTATGGCTGGTTACTGGGTGGGTT GACTCCTTTCTAAACTACAACCG

Images

Construct Design Sequences

sgRNA sequence GTCGATGTCCTTACGCAACAAGG
sgRNA2 sequence
 
left_200bp right_200bp
CTATAGTCAATCAAAAATAATCCAGCTGAGCTTCAGTTTTCTGAATACGATATCAAAGTACTTGCACCCCACTGCTTCGAAAACAAGCATTTTATTTCGAATCGAATTTGTCGAGTATCCCAAAAGAACCAGAAAAGTGAAGTTGAGCAAATGAGTTGGGGAATGTTTTAGGCTTAATTGGCAGTCGATGTCCTTACGCA ACAAGGACCCAAGGCGCAACCAGATTAGTCACTACCATACTCACATATATATACATTTATAGCCCAATACAATTGATACTGGTAAAGGATAAGTTCTGATTCAAGTGTTACCCATTTTCAGGCTGGGCATCGCAATGCTGGAAAAAGCACAATTCCGGCTCGATCCAAACGCCAGATGGAGAATTTAAGCGACCCTTTGG
 

Search Again