CR02783

CRIMIC CR02783

Gene Pat1

CG10695

Information

Donor Location Cytology FBti Stock number
int200_PM37_p0X:6590776..65969546C1

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK ACATCAAAACAGCGAGATGGCTGG TGGGCATCGAAGTTTAGGGATCCT

Images

Construct Design Sequences

sgRNA sequence TATCTCAGGGTAAATACTTGGGG
sgRNA2 sequence
 
left_200bp right_200bp
CTCCCCGAAGACCCTATACGACCTGTCGCTGCAGGCCCTCATCGGGAGTATGAACACCAAGATACCGGCGCTGGACAGGATCAGTCGACTGGCTGAGCTGCCACGCAACTTGCTCATCGATGTTTACGAAATGGTAAGTGCCAGCCACCGTTTTTTCCCCTCCAAGAATCCGAGCAATGCCATTATCTCAGGGTAAATAC TTGGGGTTAACTAGGTTCTGAATATTAATAGTGCTCTCCTATATTTCCAAACTTTACATGTTATAAGTTATTATCGCAAAATGGTACAAAATGGTAATGGTACTTTCCTATGATCTTATTATTGTAATATCTTTTTATTTTGCGGAATTCTTTATGAACATTTTATAATTTTTGAGCTGCTCAAAACACACACACACATT
 

Search Again