CR02793

CRIMIC CR02793

Gene CG11360

CG11360

Information

Donor Location Cytology FBti Stock number
int200_PM37_p14:671142..690650

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK long band CAGTCTTCGACAAATTGATT AATCAATTTGTCGAAGACTG

Images

Construct Design Sequences

sgRNA sequence CAGTCTTCGACAAATTGATTTGG
sgRNA2 sequence
 
left_200bp right_200bp
GTTTCTTGAAATTGTTTCTAACGACCACATATCGCCCAGAACTGCTACACCTTACTTTTGACAAATGTTTTGATTTTTATTCGTTTTATTGTTTTTCTTGCAAATTTCTATCGGTCTATCAAAGACACTACGACCACGCCCCTACTAGCACCTATAATCCGCCCAAAACAGTCACACACACATTCTGCCTTGTGCCAAAT CAATTTGTCGAAGACTGATTTAACGACCACAAACTGCGTAAAGGTGTCAAGTCCTCGAGTCTGCATGCTTAGTATTTAATCACTGTTCATGGTCAGACTGACTCGGCTGGTGATCCGGATCCAAAATATAAATACTATATATATATATATGTATATATATATATATATACTATAATGGAAATAGGAAAATTCCAGTAACT
 

Search Again