CR02816

CRIMIC CR02816

Gene dbr

CG11371

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p02L:66482..7139021B1

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK TTGGGCTTGACGCTTTGAGATAGG TTCCCTCGCATTCTTAGGCTGGAA

Images

Construct Design Sequences

sgRNA sequence TTTGATACTTATTCAGATCTAGG
sgRNA2 sequence
 
left_200bp right_200bp
TCGTAACATGGATGCTCAGTTTGAGCACTTGTGCCGCATTTGCGCTGCCAACACGAAAAGCAAGACGAATTCCGTGGTTGAAAGTGTGTTTATTTTTAAAACACAGGGACTGAAGGATAAAATATCTCGACACCTTTATCTAAATGTAAGTAAATAAAAAGGAACAGCCTGTTTGGCGCTGCATCAAATTTAATCCTAGA TCTGAATAAGTATCAAAACAAGACCTCCGCGTACTTGCTAAGACTCGACATTTAAAAAACGTATTTCTTTTTAGGTAGCTGAAGAAGATCCTCTGCCAAAAGTGCTCTGCAAATCTTGTTACCGCCAAGTAGAGGCCACGGCGTCGCTTTCAAATATAGCAAAACATACTCAGCTCGTGTTTCGGGACTTTCTCCTTAGT
 

Search Again