CR02835

CRIMIC CR02835

Gene CG34039

CG34039

Information

Donor Location Cytology FBti Stock number
gRNA_int200_pM37_p03L:14560000..1456261370E2

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK GCTTTGTCCCTTCAATTTACATGGGTAC CTCTCCACAAATTCGTTGTGCCAC

Images

Construct Design Sequences

sgRNA sequence AATTTACTCAAAAACGTGATGGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
 

Search Again