CR02857

CRIMIC CR02857

Gene CG32485

CG32485

Information

Donor Location Cytology FBti Stock number
gRNA_int200_pM37_p03L:3050323..305176563A5

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CAGGACTTCAAGGATCTCAAGGAG TGTCTCACGCCACTTGTTGGTCTT

Images

Construct Design Sequences

sgRNA sequence GCTCAAAGGGGCTAATTAAGGGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
 

Search Again