CR02918

CRIMIC CR02918

Gene Trf4-1

CG11265

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p0X:8560322..85701597F4

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK ATGACTCCGAGGATAGCAAGGA GTTGCTGTTGATCCTCAAGCTC

Images

Construct Design Sequences

sgRNA sequence ATGCCCAGGCATCAGGTGGTCGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again