CR02922

CRIMIC CR02922

Gene CG12730

CG12730

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p0X:5516608..55187715A2

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CAGGTATCTCCGGTTGTGGCA GCAAGCGATACTCGCTCTCTCAAA

Images

Construct Design Sequences

sgRNA sequence CAGAGAGTTCATCACAGCGAGGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again