CR02933

CRIMIC CR02933

Gene CG32814

CG32814

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p0X:1019795..10267001E1

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK AAAGATTCGGGATCTCGTGCAGTC TCATACAAAGTGCTGATATGTTCAGAAC

Images

Construct Design Sequences

sgRNA sequence CTGATCAACTGCTTATAATAGGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again