CR02934

CRIMIC CR02934

Gene CG6414

CG6414

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p0X:3968788..39713504A1

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence CTTCATTGAAATTGGTTATAAGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again