CR02935

CRIMIC CR02935

Gene CG1572

CG1572

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p0X:11555050..11558654

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence GAAGTATATATATGTACGTTTGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again