CR02937

CRIMIC CR02937

Gene RhoGAP1A

CG40494

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p0X:127449..140340

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK long band GCGTTGTCAGTTCATTGAAGACCG GCATGATTTAACGCCTTCGTTAATGAAACAC

Images

Construct Design Sequences

sgRNA sequence GATTTCAGAGCACTGTAAAGTGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again