CR02942

CRIMIC CR02942

Gene Hr4

CG43934

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p0X:1941940..20079562C1

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GTACGTGGTTCGATTTGCAAAACC CTCGATCTTGATCTTGGGCAGGTT

Images

Construct Design Sequences

sgRNA sequence GGTGATGGCTTTGTCGGAAATGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again