CR02965

CRIMIC CR02965

Gene CG15673

CG15673

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p12R:21608393..21613071

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK (weak) OK TTGGAGTTCGCCTATCTGCAGCT CCACTTCTGCACGCACTACAAACT

Images

Construct Design Sequences

sgRNA sequence CAAAGCGAACCCAATGGAAGTGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again