CR02970

CRIMIC CR02970

Gene CG44005

CG44005

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p13L:18070300..18072123

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GTCGCCGAGCTGAAACACTTGAAA CTGCTCTGCATCTATATCCTCTAC

Images

Construct Design Sequences

sgRNA sequence AAAACAAAAGAAAACAAAGACGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again