CR02981

CRIMIC CR02981

Gene CG41128

CG41128

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p13R:3750363..3752352

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK ATGGCATGAGTAGACAAGTGTATTGTT TGGAGGAAGTCCAATGTGCACGAA

Images

Construct Design Sequences

sgRNA sequence AAACGAGTTGGCTTAGTAAGAGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again