CR02983

CRIMIC CR02983

Gene Hexim

CG3508

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p13R:14659438..1466117788C10-88C10

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GCACCTGGTTACACTTCAATCGAG TGACATATCGAGTTTCCACTGCGG

Images

Construct Design Sequences

sgRNA sequence AATGCAACTCTGCCCACTGCAGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again