CR02994

CRIMIC CR02994

Gene CG18744

CG18744

Information

Donor Location Cytology FBti Stock number
gRNA_int200_PM37_p13R:7797078..779877184E1-84E1

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK GCATGTTGTCAACAACTGCCAGAC GGCCTCCAGGCATATTGCTGAAAT

Images

Construct Design Sequences

sgRNA sequence GATCGGTGAATCAGCGCCACTGG
sgRNA2 sequence
 
left_200bp right_200bp
 

Search Again