CR60082

CRIMIC CR60082

Gene Cep135

CG17081

Information

Donor Location Cytology FBti Stock number
PM37_p0 3L:15116737..1512802971B5FBti0217029 Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence CTTACTGAAGAGATTCAGGTTGG
sgRNA2 sequence
 

Search Again