CR60261

CRIMIC CR60261

Gene DNaseII

CG7780

Information

Donor Location Cytology FBti Stock number
pM37_p2 3R:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
long band multi (weak) GACATAACAAATCGGTACACCTAAGT ATCGCAGCTATTCGGTAAGTTGCC

Images

Construct Design Sequences

sgRNA sequence TAAATGAAAAAGTATGTGAAAGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
ACAGCCACCAGCGATAAGAACTAACGAAGTTGAATTCAATTAATTTACCAGACAGTTTATTTCCAATATAATTCAATATTAGCAGATGGGCTCGCCCGCCCGCAAGACAAATTATACAATTTGATAACGATAATATTTTCATGCGATCACGATCGAGGAGGAAAGCACAAACGATATGCCCTGCAATGCAAACGGGGAAAAGAGCAACAAATTGCAGTTTTCAGCAGGCGACAAATTATAATAATACAATACGAATAATAAATAAAAACTTTAACAATTGTTTTGTGTAATTGTAAAGAAGTGGAGTTCTTTTCACCGCCAGTGGGATGAATGGGATGTTTATGTGATGATGGTGAAATGGGTAAGTATTTATAATATGTTACAGATTGGACAAGATTCTTAGTAGTTTCTTATAATATCCATAAAAATGAAGTCAAACATATTTAGTAGAGTATAATATATTCGTTGTAGCCGCATTTAGTGCGCTTGGCTTATCAGCGACCTCTCTGTTCGACTGATCTTTTGCAATAAGTGGCTGACCCCTCAGATAGCAGACAACGTGGCGATAGGCTGTGTTAAAAACCCAAACACGACCAAATATTTACAAATCCAACTTTTAGATAAAACAGACAAACAGCAAGGATCTCAGTTTTCACTCGATTCAAGCGTTTTTACCTGGTGAAGAAATCGAAAAAGATTAAGATGGATTTCAATTTGCGACTGAGACACCCTGTATGAGCACAGCCGTTGATTGGATTGGATTCACTGACACTTATTTAGTTGTTTTCCGGCCGAGCAACTTGAAGGTTGTACAATGCGATCTCTGTGCTTCGTTTTGCTGTTCGTTTGGTTTTTCTACCAAAACGAAGCTAAGTCTAAGGTTTCCTGTAAGGATGAAGCTGGAAACGATGTAGATTGGTAAGTATTTCGATTAACAGATC CTGCAGTCGCTGTTTGCATATCATTAACAATTTGCAAACACAACGTATTTTAGTTATTTATATACACTGCTGTATTGAGATTATTCTAAAAGAGGCGATAAACAAATTGAATATGATGAGTTCAAGTTCAAGCGGAAAAATTGATAATAATTGTACAATACTGTGTGACAAGAAATTAAAAAGTAATTAGTGTGTTATTTTGTTTCCTAAAATGAGAGATTTAAATCAAAGTTGTTTGCTACAAACAAACTTAATCAATTTGATAACAATAACATCATTTTTAATACTTTTCCATTTCCAAAAATAGATTAAATGGTAATTATTTTTTTTTTTTAATATCTTAAAAACAAATTTCCAAAGATTGAGGGGTTTTCTCGATGAGATAAACATGTTTTTAATTTATTTAATAATTTTTTTTCAAATATTCCTTTATAATTTTAGGTGGCACCTTTACAAACTGCCCAAGCACTACCAGCACAACGATTTGGGCAAGGACACCAGTGGCTTGAAGTACCTGTACGTGACCAGCCAGAACTATGACACCTGGCAGATGTCGGGAAAGTTCATTAGTGATCCCCTATCGCTGCCTGCCCAGACCCTTAACCCCTTGAACGACGATCCCAGCCACACTCTGCTGGCCGCCTACAACGATCAACAGCCGAATGGCACGGTTTTCAGCAGCGGTGGTCATGCCAAAGGAGTGGTGGCCAGTGATGGGGAGACGGCTATTTGGATTGTCCACTCGGTGCCCAAATTTCCAACAATTCCGGACTACAGCTATCCCACATCCGGCGAGCAGTACGCACAGAGCATGCTCTGCGTCACACTGAAGGGCGAGGATTTGGAGAAGGTTGGTCAGATTCTGGTGTACAATGAACCGCACTTCTACTATCAACGCAACCCGCTGGCCACTCGCTCCGATGAGCTGTTCCCGAGCCTGGAAAGGGCTCTGCATGGTCAGTGGCGGACGGAATCACCGTTCCAGAAGGACTTGGAGGTGCGCAGCTTGGACGGCAAGAAGTTCC
 

Search Again