CR60266

CRIMIC CR60266

Gene CG11999

CG11999

Information

Donor Location Cytology FBti Stock number
pM37_p1 3R:..FBti0219208 Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK TACCACTCAGTTGTGCTGCTGGAA CCTGGTAACCTACGCATGTCTTTC

Images

Construct Design Sequences

sgRNA sequence GGAAGGTTCAGAAAGAGGGGCGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
GGCAGTGGGAGCTGAAACTTGCTTGGCTAGTGGAGCTGCAGCCGCTGGAGCTGCAGGTGCAGGCACAGGAGCAGGTTGAGCATTGCTGTTGTTGTTGCTGTTGGTGCCGATCGCTGGGAATGTCTGCGCCGCAGTCTCAGCCTTTGTTGATTGTTTGAGGGGGAAATGAAAGCGGATTAGTGGGGCAGTCACGGGATGTGGCCAGTCATCATACCCATGTCACGCCAACCAAATAACATATCACCAGTAGCACCGCGTAGACGAACAGGCGCTTGTGTGCCATTAATTTTTCTTTAATTTCAATTTTCCTCAGTTTTCTTGCCTTTTATTGGAGAAAATTCCCTTGCAATTTCGCAGAGTGACCGTACTTGTCTGGTGCACAGAAAATACCAACAAATTGTCGCTCATCGAACTAGTTCCTTTTGGTGCAATTAGTTTTTAGGCTAATTATTAATAACTAATTATTTCCTTCACGATATAACGTTCATTTAATTCTAAAACAATCAAGAAATAAGTTTCTAGGCGTATCAATAAATCTGTGACGTCAAATTCGTAATCTGCTCTCTGAAAAGACTAATTATATTTTTCCTTTATTCAACATTTATTATATACATTAAGCTATTTTCCGTTAATGGAATAAGTTACAGCAATATGGAGTTTGTTATAGTATTATGTTTATTTTTTTCGGTGAGTCCATAATTTGGATTTTACCGCAGCCTGGTCACACCAGCACCGTCAAAAATAGCAATTGTTTGCGTGTGCAACGCTGATTTCAACCGTAATTGCCGGTACAGATTGACTGACTTAGGTCCACGGACTAGGATACGATAACTAGAACAGGACACGATGCAGCACATACTACTTCTTACAGGACTGGCGCTGGTAGGCAGCATTTCCAGGGGAGCCGGTAAGTGGCGACCTGAAACAAAGTCGCGTCTATGTGGTCTTCTCTGATTGGCCGCCC CTCTTTCTGAACCTTCCGTGGCCATAGTTAATGCTTATCTTATATTCTATCTTGACCCTGCTGAACACAGCCACCGAATCCAACGTGGTCACCTGCGGCTCCATCCTGAAGCTGCTCAACTCGGACTACGCCTTCCGCCTGCACTCCCACGACGTCAAGTACGGATCTGGTTCCGGGCAGCAGTCGGTGACGGGCGTGGAGCAGAAGGAGGACGTGAACAGCCACTGGGTGATCAAGGCGCAGACCGGCGAGCTTTGTGAAAGGGGCGAGCCCATCGCCTGCGGATCCACCGTGCGACTGGAGCACCTGTCCACCAAGAAGAACCTGCACTCGCACCACTTTTCGTCGCCGCTCTCAGGCGAGCAGGAGGTGTCCGCGTACGGAACGGATGGACTCGGCGACACCGGCGACCACTGGGAGGTGGTCTGCTCCAACGAGAACTGGATGCGCAGTGCCCACGTTAGGCTGCGCCACATCGACACCGGCATGTACCTGGGCATGTCCGGCCGCTCCTATGGCAGACCCATCTCCGGCCAAATGGAAATCGTTGGCGTCCACAAGCCGCAGCACGGAACGCGCTGGACCACGGCGGAGGGCCTCTTTATCGTGCCCAAGGAGAAGAGCTCAACGCACGACGAGTACGCCCACTCGGAGCTGTAGTGCTCCCTAAGGACCTCGACTGCTGCAGTTTCATACTACTATTAGTTCTGTAATTTATAACTTAGTTGAATTTTTATTGAAGACCCCAAAAGCAAACCATCAAATTAAAATTATTTAAACTCAGGGTACTTCGAAACTTTCAGATTGCTTTCATCGAAAGTTATGTATTCTATGTATGTATTATGTATTCTATCTAGAAAGTGCCTTGCATAAAGGCAGTCGTAAGAACCACTTAGCTTAAATGCATTGCAACAAATGGGGGCGTCTATAGAGCCCTTTTTAAGGTAGTGAAACCTCAGTTGCAATCTAACTTTTCTAAATTTTTCTAGAACTTTGATTGATTGTCTACTTAGTCAGTTGCAGGCACACAAATGCTTTTTTATTTTTATGTAACCTTTTATATTTTAAACGGGTATTTTGAGGCAATAGTACTCTTTCTGTTG
 

Search Again