CR60319

CRIMIC CR60319

Gene CG9119

CG9119

Information

Donor Location Cytology FBti Stock number
pM37_p1 3L:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
no band OK CCGAGTAACACCCGAATTGAAC AGTCGGCTACAACTAGATACGGCA

Images

Construct Design Sequences

sgRNA sequence GGTGCCGAACTTTCCACAGCCGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
CCACATATACACACTCTTATCTGATACGGCCCACTGACGTAGCAAACGTGACCGCTAAATGACAAAACTCGATCGCGGATCCAACCACGGGCACTATCAGTGGACACCAACCGAAAGAGGGCTGGACTTATCAGTGGGGTACAGTGAAAGGTGCTCTGCGTGGACCGCACTACCTATTCCTACCACAAACAGATATTCTTAATTGGCCATCAACCAAGTCGTTTGAAAACATTTGGTTTGGCTTAATTTATGGGTCAGTTGGGGACAACAACTTTCTTGGCGGCTTTTGTAGACAGAGAATATGTAAATGTGAGCCATCAAATGGAGCAGCAACCAGTTATTTTAGGGTCCGAGCCCTATAGAACCTTTACGGGCAGCGAAAGTGACAACGAAGTGGAAAGTTTTTGTGGCATTCATGGAAAAGTGTGTGCCTCACATTGACATAGGTCGTTAAACGGAGGTGCTACTGTAACGAAATAGCCGCACCGTAAATACGCCTTCCTGACATGCGCATTAAGCGTGAGAGCTGATGGATCGCTCCACCTCCCCGCAGGAACCTTAAGAACTCGATCTCGACTCTAATTAAACTAAATACGGCACAAGAGTTTATCTTATCGGCGGATGCACCCTGTGCCGACCGGCCGTACCAGCAATGTTAACTATAGGGCAAACCGGGAGCCGAGCACTCAACTTTAAAAAACGAGACCCCATCTGGTTTCAGCAGACAGTCGTGTTTGCAACGATCTAGCGAGCGGTAGGTAGCCTCAGCGCGACTAGAATACTTGGTGGGCTAGAGAAAGGAATCCAAACCTGAATCGGAACGAGGCCAGAATCGCAATAAGGAGCAAAGTAACTAGGACACATCTCCAACCAAAATGAGCCAGAACCAACTGAGTACGGAGCAACTGCTCTTCGAGGAGAAGCCGCTGTACGTGCCCCCATTGTCAGAGTTGCAGAACGGTGAGTCGAGTTGGATTTCCCAGCGATCCCGCAGATAACAATACGTGCCATGTGCAAATGACCTTCAGCAGAACGGTGCCGAACTTTCCAC GCCGGTTTTCGGTGGGTTCTACGTTCTGTGTTTTTTGTTTGCTGTTTTCATTGAGCAAATCTCAAACAGAAACAGAAACATATGATTGGCGGTGGAGCTTTTGCTCAGCTTTTGCCATATCTCGTCTAGATGGAGGTCGAGATAAAGCTCTAATGGTTACCCTACCTCTCTCACAGTTATACAGGGTGCCCTGGCGGCCAACTTCGCCAATGTGAATGTCAGTGTGGGCCCTTGTCCGGATCTGAAGGCCAAGCAGTTCGGCCTGGTGGAGAGTGGACTGGGCGGCAAGCCCACGCTGCTGGAGGCGGGAGGCCCACCCTTTCTGCTGCCCCTCGTGCAGCGAGATAAGCTGTACAACATCGCCGAGATCACGCGAAAGATCCAGGGCCCCGGCACGGTGTTCGCCGTGGGCGCCGGAGCGGGACCTTGGCCCATCCGGGGATCCAACTGCGAGGGCATCTTCAACTTGTCCGTGAACGAGAAGGATGAGCTCACGAACGGCAGCTACACGGCCACTGTGAGGGGAGAGCAGGAGGAGTGCGTCCTGGAGAAGATACCCCACACAGAGCCCAGGTGCGCCCTGCTTCTCAACCTCTTCCTCAGCCAGGGCAAGCCTGGTCAGGTGTTGAAAATCACCGCCAAGCAGCGCACTGGCGAACAGAACTTCATCGAGTGCATCCGCAAGGGCCTGGAGAACCACTACGGGGACAAGGTGGTGGGTCTGGGTGGCATTTTTCTGATCAAGAAGGGCGCTGCCCACCAGCACGTGATGCGGGACTTCAGCAAGACGCCCATCAACAGCGACGAGGAGGTGAACGAGTGGCTCAAGTTCTACGAGATGCCCGCCCAGCTGAACGCCGTGGGCACGCTGGTGACCAAGGAGCACGACCTGGACCTTCGCCTGCAGCACTTCCACTCCTTCTCCTTCAGCAACTGGGGCGGTCACTACCATTACGACACCACGCCGGATATCGTTGAGTACGAGGCCTACCTGAACGTAGCCGAACGGGTGGTGCGGGTGGATAAGCCCGTGGCCACTCACAAAGTGGGACGCGACTAG
 

Search Again