CR60381

CRIMIC CR60381

Gene CG5612

CG5612

Information

Donor Location Cytology FBti Stock number
pM37_p0 3R:..94409

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CTGGTTTTGGCCAAAAGTAGCGAC CACGCTATCATTGTACACTCCTGG

Images

Construct Design Sequences

sgRNA sequence GTCAGACCGCGTAAACATCTCGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
CCAGCTCCTGGTCAAGGATGTGCTCCATTCCCGTCCAGCCGGCGCCGGCGAGCTGCCCGGAGTGACGTTCACCTACGAGATTTTGGAGCCAATCACTTGCGTGGAAATTCTATCGGAGGAAGTGAGTGCGGGCTTTTAAATTCAACAAACTATTTAAACTTTAAACTACCACTTTTGAGCTCTCAAAAAAAAAAAAATCTAAAAATATGGCACATACAATTTGACAGCCGAAAGAATAAATTGATTTTGTTGTGTACACAGCACAAGCTTGTCATGTAAAAAAGATGCAAATTAGTTTCGAAAAAAAAAAAAATTGTAAAGACACAAAATATTCCTGCATAATTAGACAGAATCTGGGTATTTTGGTTTATGAACAAGTGAGCGATATGTGCGGATATTCTGACCCCTTGTTACTTTAATAATATTTTTTTTTATTATTATTTTGCACATGCCCGCAACGAAAATAGAAACAGAAACTGACATTTTTTTTTCGTCACAGCCAAGCGACATAAAGTTTGGCCCATAGATGTATTTTTATATATCCAGTGCGTTTTGCGGCTGCCGGGCTGTGTTTACTACATATATCTATTCAACTTTACTATATCTACTATATGTATGTTCATATTTTTGTTTATTTGTTTTGCCCTGAAATATGAAGCACGTACTATTTGGTAAAGTGTTCGATTTATCGACAACTGGGTCGATAATTGAAAATGAAATGAATAAATATGTACTTATATTGTACGGGGAAAATCGCATACTTTGAGGCCAATAAAAATAAAATAGCGTGAGGAAATGTGGCAATTTGGCAAAGCCGACAAGTTAAATGGACGAGAAGGGTGGCGGGAAGCAAGCATATATATTATTTCTAGAATAACAAGAAAGAAAACTCGAGCTGTATGCATTTTCAATTTGAGCATTATGACGCGGGATTTTCCCTAGAAAATACACATTATTTATTCGTAAATCAACTTTGGCGAAGTACATATACGTCGATGTCCGTGAATCGGATTGTCAGACCGCG CTCGGAAAAATGTAGCAATCGCTGATGGATGTTGCCGTAATGGTCACGCCCGATTGGATCTGTCCAATTTGAAGGGGATTTCTCATTTGGTTTCTCCTTTGCCATTTCAGAACATTTCGGCGGAGGTGAAATTCAGCTTGGTGAATCGCCTCATCGTGGGCATAATCCAATTGGCTGCCAGCAATCAAAGCGTTAACCCATCAGCTCCCATTGTTCCACCAACCGTCGAGTTCGATGTGACCATCATGGTGTTTGGCCTAAATGAGACCTCCAAGCATTTCGATCCCTCACTGGTCATCAATCGTGATCAGCAATTTGAGGGCGAGATGGAGCCCTACGAGGAAATCTTCCCGGAACCGGATCAATATGTTGAGGTATTTGACAACAATAGACGCGATGACCTGGAGATCGACGAAGGTGATGACAATCTGTCCGAGGAGGACATCGAGAGCTATACGGAAGGTCCATTCGTAACAGACTATTTCGATAAGCCAGACAAATACATTGAAGTTGGAAAAAGGCAGGCGGGTAAGTTTATCAATAATCATATCTTCATATGATATCTGATAATAAGTGACCTTTAAGGCGATGAACTTCTCTATGATTGCTATCAGACATCGCCGGATGATTCGGAAAAGCCAACCAATCACTCGGTGGTTTTCTACTACATCGACAATAATCTAATAACATACGTGCGGTTTGCTATACTCGATGTGAGTAAACTATGGTTAAAAGTTCCATGTTAATACATTTAATACTTATTAAATTTGTACACTTTTTAGCACTATGCCAATAGAAATATCTCGGAGGCCGAATACCAAGCGCCGGTGGCAGAGTACAGTCACTATACGAGTGGCACCCTAAAGGCGGTCATCACCGACTACGATTCGAAAAGCCTTTTTGTCCAGATGTACGTCTACGGATATCGGGGGCGCACAGCGCCGCCCACCTATGAGCCCTTCCTGCCGCCGCCGCTGTGGCAAAAGGCAATTCTGGAGTCGCGGACCAAAAGCAATGCCACTCCGCACCTG
 

Search Again