CR60397

CRIMIC CR60397

Gene pasha

CG1800

Information

Donor Location Cytology FBti Stock number
pM37_p1 3R:..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK

Images

Construct Design Sequences

sgRNA sequence GAAGATGGCCATCAACTTCGCGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
GTTTCCGCAAAACTGCATGTGGTGTTTGTTTCGCTTGTTTGGTTATTTTTCCCAACTAACATCCTCTCTCTAAAATCTCGATTTCGTACTTGAATTGCGCAGCTTTTGCTTTGGGATTTTGTCCGACAATTAGGCAGAATCCATAGCGAAAGACGCAGCAAGTAGCATCGTTTACAATCCGCGAAAGTGCAGTCGCAGAATTTTCCGGCGGGGCTTCTGGCTTAACCAATGTGGCACTTCCAATGAGAAATCAATTGCAAGGCGTTGGATGCTCTCAGTATTGGTTATTGGCGAGATTGGCCCCGGGACAGCATTACTAGACAGTTCCGATCAGTCCGCACTAAACCCCTCCCGCTTTAGACACACACATCCAATACAATGGCGGAGAAGCCGCTGGCCGACTGCCCGGACTCTGGGCAGGTCCGCAAGCGTCCCCGGCTGGAGGACGAGGAGCAGGAGCTCAAGGTGGCCGGCTTTTCGCTGAGCGCCATCGAGGAAATGCGGCGGACCAGGGACAACGAGCTGCAGAACGAACCCATGGACCAGCAACTGCGACAGTTCCAGGTTCTCGACGAAGTCGGCTCTGGCAGCGATGAGGATGATGAGTCAGGTGAGTCGGAAACGAAGCTCGGATATTCACTCAGGTCATCCAGATCACAGGCTGTGCAATTACCACCTTTTGTTTCACAGTGCAGGCGCAGTTCTTATCTCAAGATCTTGGGGGCCTATCATTGTGCAAATACAGGAGGCTGATAAAAGAGTCAGCCGGCAGGTTAAACCCTGATATAGCAGCTTCAGTTTTCCTTTATCTTATTGTAAGGCAGGTGGTGGCAGTTTTGTGCGGACAGTTCCATGCGCATGATACCCATTATCCGACTGGCTTGTCCAGTTGCGTCAGGTAGAGCCAGTAATAATGAAGGATCACTTTAATTAAACATCAAAGAGCTAGACAATTAGGTGCCAATGGCATTCATTCAAATATTCCGTGAAGATGGCCATCAAC CGCGGCTGGTTTTCCATTTCCCAGACAAACAGACAACTTATTTATCCGTGATTGTATCTCCTTACATGGCAACCAGACAACGCTAGCGAGCAGCAGGGCGGAAGGTATGGAGAAGGAGGCGACGAGGAGGAAGAGGCGGCTGATGGTGACGGCGAAGAATACGATTCCTCGGAATTCGATGATGACGAGATCGAGAATCTGCTGGACGAGAAGCTGCCCGAAGAGCTCCGCGAGTCAAAGCAGCCCAAATACGAGCAGCGTTTCAAGACTGTGCTGGAAGGTCAGTGCTTTTCGTCGAACCAAGTGTCCAAGATGACGAGTATTTTAATGTGACTACTCTTTTAGAAAAGCGCCTCAACCACTTTGAAGTCCTACCCGAGGGATGGGTGCAGGTGACCCACAACAGTGGAATGCCGCTCTTCTTGCATCGCAAAACTCGCGTCTGTTGCGCATCGAGGCCCTATTTTCTCGGCACTGGAAGTGCCCGCAAGCATGCAGTGCCCTTGGGAGCAATCCCCTGTCTTAACTACAGGCGGGCTTTGGAGGAAGAGTCGGAGGTGGAGCAACAAAAGACGGATGGAGCGCCGCCAGTGGCTGTATGTCCCATGGCCGGAGCTTCCGCTTTACCGGCCGAAGCCATGGACGTGGAGGGAAAAGAGAACAACGAAGGCAGCACCGATTCCAAAACCCAACCAGATGGAATAACTGCCCTTATGCCGGCTGCTAAAATTGTTACGGTCAACGAGAATACCCAAAAGGAATCCATTACACCGGAGCAACTAAACACCTACTGCCAGAAACTCTTCAAATTCAAGGTGATTCGTGTGCTGCGATTTCGGAGTTGGAATGCTCGCCGCAAGTTCACCAAAAACCGCAAACACATCAAGAATATTCAACGACCCACGCTGCCGGATGGCACTAAGCTTATTAAGTTCCCAATACTAGCGAATGCTGGCGAAGGATCAACGAACCCGCGCGGTCGGAAGGAGTGGATCATGAATCCCAATGGCAAGAGCTTCGTCTG
 

Search Again