CR60410

CRIMIC CR60410

Gene rost

CG9552

Information

Donor Location Cytology FBti Stock number
pM37_p0 2L :..Order from Bellen Lab

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
short band OK GTCGAAGTCAATGCATTTGAAATGG TATCAGACCCACAGCATGAGGAGA

Images

Construct Design Sequences

sgRNA sequence ATTAATCGATGATCATGTAAGGG
sgRNA2 sequence
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
 
Amplicon 5' Amplicon 3'
CGAAGCTCCGCGCATTAAGCCAAAATATAACCTGAGTACCCCAGGGCATTCTATATCTGCCATCCATTAGAAATACACTTAAAAGGTAAAACTGGCTTGTATACCAAATGTTCATTAGAGTGTGCTCAACAAAAAAAAAAAAGCGAAGTTCACAGAGAACATAAAATGTTATGGTGAGAACACATTGTACACGCAGGCATTGTTAATTAATTCGTATTTAATTAGCACAGCTAAACTAAAAGCTGGGCTCTATTCAAAGTTGTATTGCTCTAAACAAATATCACGAATAGAACAAACTAAAGTGTAACCCAAATGGATATGAAACTATGTTTTTAACCAACTGTTCATGAATGAAGGCAAACCATCAAAAACCATCAGTTAAGTGTAAAAGAATCTTTTATCACTATATATTTGTACACTCATGAGCAAATATAAAAGTTATATGGACAAAGATATCTACAAGACCATGATGATGATACCAAGTTAGATAAGAATTATGAAATTTTGAGCTCCCTTTTTCGACAATTCATTCTGAGTATAATCCGGCAAGAAAATACCAATCGGCTACATTAATGTTTTTGTGTCAACATTATGAGTCATTTTAAAATCACCAAAATAAATTCCCTTAAAAAAGCCAAGTACTGAAAACCCCTGATAGTTATTGGAGCTCTTCCATAACACTGATTACACATTTCTCACGAATGAAATACTAATCAAATCAAAACAGGAACCAGACAATAGTTTTGGCGCTCGCCATAAATATTCTTGCTAGACCTTATCAGACAGCCAACAACAAGCCATAAACATCCATGAAGGATCGCGTTATCTAACGAATCAATGTTTTTATTTCCGCAATATTTAAGTTCTAAACAAATAAATTTGAATAATACTACGCACGCAACAAAACTAAAAGCTGTGATGCGACGAAGGTGATATCAGTTAGACAGGCCCTAATTCGGACTACGTCATTGCTAGTGATAAGCGCTTAGCATGTTTGTTAACGCGGGCAAAGGTGTG GGTCAGACTGGTGCACGCGATAAGGAATTCGCTATCAATCGCTGTCACAGCAACAATGTAACAATGAATTATTGCCCATATATAATATATTTTTAATTTAATCAATTGTATTACATTAATTATTAAATAGCTAAAACTATATAATTCTCGTATTGCAGTGGCAAAAAGATGAGATCAACACAATATACTTGCTCTACCGATGGATTTGGGCACTGTTTTTCCTGGGCGTGTACATCATGTGCGTTATCGTTCAGTTTTGCGATGGAAAGTTCTTCATCTACATGACCAACTGGGGATTCGGGCTCTGTACGATCACCATGCTGATTTCCGCCGTACAAGTCACCTGCTGGCACTTCGATGTGAGGAGCACCCGGAGCCTGGTACAGGAGTCCGGTCACAAGGCGGAGACGTCGAGGGGCCTGAAAATCTACTGGTGGCTCTACAATATGACACTGTCGCTGGCTCTGATCATATCAACAGTATACTGGGTGTTCCTCCATGGAAAAATGAGTGAGTATTGCCGTATCTGCGTTCATTATTTACATTGCTTTAAATGACAGTGGTGGGTGTGCAAGCTATTACATACCTTACGATATCTATGTGCAATAGAGAGAAAGAGGGCATATTTTATAACATATTTAATGAATTTCCTTTCGTTACAGACAAGCCCATGCGATTCCCTGCCATCAGCATTATCACCCACGGCATGAATTCTGTGATGATGCTAATCGATTTCCTGGTCATTGCATTTCCGCTTAGGATACTTCACATGGTGTACGGAATGAGTCTGGCGATATTCTTCTTTTTATTCACGCTGATCTACCATTTATGCGGGGGAACAGATGAGTGAGTACTTGAAATCTTACCCGTATACCTTGCAATTTAGAGCTAATCACCTTCACAATTCTCCTTCAGATTTGGCAATCACTACGTGTATCCCATTCTGGATTGGAACAATCCCAACCGCTGTATGGTGACCTTTGTGGGCATCTTCCTGCTCATTATGTGCTACTGGGTGCTGCTCTTTGGACTCTACAAGTTGAAGAGAATGTTCAATAGGGCATTCAGTGTGG
 

Search Again