CR70069

CRIMIC CR70069

Gene Bap60

CG4303

Information

Donor Location Cytology FBti Stock number
int200_PM37_kG4 X:13157445..1315950811E1

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CTCCTTTGCGATGGCTGAGTTCAT TTGTGAGATGACTCAAACGCTGGC

Images

Construct Design Sequences

sgRNA sequence ACACAATTTCGCCTGTAAAATGG
sgRNA2 sequence GCCGTGCGCACGGTTTATGGAGG
 
left_200bp right_200bp
TATCGTATTGTTTGTTTGTTACAAATGTCTTGAAAGTTTTTAAGTATATTTTCAAAGCCAACTATATAGCTGTAACTCTATTGAAATGAATAACTTCGATTAAAGTGCAAAATGATAGCCGCAGCCCTGCCAAACGTTGTAATATCTATCGCCCAGTCGACCACCACCAGTAATAGTGCATCCCTGTTTTGACGCCATTT TAAACCGTGCGCACGGCAAACTCTTTTTCCTTCGCCAGTTTAGTTTAAGCTTAAAATATTTCCTTTTTTTCCGACAAGCCGAACTCCATCCCGTTCCAAAACGAAAATCCCCTTTGCAGTTGTCCCAAATACCCACATCCAGCACAAATATTGGACTTAACTGTAAGCTAATAAAATGGCATACAAATATAAAACTGTCT
 

Search Again